Table 4.
Oligonucleotides Used in the RT, PCR, and SPMS Reactions
| Mutation | Primer sequence 5‘ → 3‘ | Direction | Size of PCR product (bp) | Incorporated [3H]dNTPs in SPMS reaction (normal/ mutant allele) |
| 517C → T | 1. PCR: ATGATGGCACTGAACTCCT | antisense | ||
| and | 2. PCR: Bio-CGGGGAAACCTCAACAC | sense | 62 | |
| 518G → A | 3. MS/517: GTCCAGCTTCCGAAGCC | antisense | GGG/A | |
| 4. MS/518: GTCCAGCTTCCGAAGC | antisense | C/T | ||
| 673C → G | 5. RT and PCR: GCGATGCAGCGAAGCAGAGTC | antisense | G/CC | |
| and | 6. PCR: Bio-CGGCCTTGGGCGTGGAAG | sense | 94 | and |
| 673C → T | 7. MS: GATGTCCTGGTCCTTGGCTC | antisense | G/A | |
| 713T → G | 8. PCR: CCTTTCAGCGATGCAGCGAAGC | antisense | ||
| 9. PCR: = 6. | sense | 101 | A/C | |
| 10. MS: AGCAGAGTCTCGGGATCGTGC | antisense | |||
| 1073delA | 11. PCR: CATGAAGATGGCCCTGAGGAT | sense | ||
| 12. PCR: Bio-GGCATCTGTGCCCCACAAACCAG | antisense | 197 | A/C | |
| 13. MS: GGATGTTGCACGGCAGCTTA | sense |
-
↵Specific activities for tritium-labeled nucleotides: [3H]dATP, 59 Ci/mmoles; [3H]dCTP, 64 Ci/mmoles; [3H]dGTP, 31 Ci/mmoles; [3H]dTTP; 119 Ci/mmoles. (Bio) 5‘biotinylated primer; (MS) solid-phase minisequencing detection primer.











