Examples of Introns Unique to One Species
| A | cccaatccaagagaggtaactattttt | … | taattctttttcaggtatcctaactctc | briggsae |
| cccagtccaagagag------------ | … | --------------gtatccttaccctc | elegans | |
| B | agaatgtctgtagta------------ | … | --------------gaaatgaacaagcg | briggsae |
| agaaattcgttggtggtaagctttaca | … | ataaataaattcaggaaatgaacaaacg | elegans | |
| C | ctacatttttcattggttcgttttcca | … | gagtcgctttcagttaaa-aagtat-tt | briggsae |
| ccactttctttattg------------ | … | --------------taaagaagtatctt | elegans | |
| D | agttttcgagatcacacaggtaaccgt | … | atgatcttttgattccagcacatctccc | briggsae |
| agttttcgagatcacCcag-------- | … | ------------------cacatttctc | elegans |
-
(A,B) Two of the 263 inserts in highly conserved coding regions that align optimally with the GT … AG ends characteristic of an intron. (C,D) Other inserts in coding regions that are potentially introns that have been inserted or deleted and have undergone additional mutation as well. (C) An insert that is likely to be an intron with additional single base insertions or deletions in the flanking region on the right side. (D) Another coding insert. In this case the mismatch at the location of the capitalized C has to be introduced to get GT … AG ends at the insert. Note that 4 nucleotides to the left of the insert could be slid to the right of the insert and not require any mismatches.
