In Silico Cloning of Novel Endothelial-Specific Genes

Table 8.

Summary of Available Information on ECSM1-3 and Magic Roundabout

UniGene cluster ID and size Full-length cDNA Longest ORF Transmembrane segments, signal peptide Mapping information Genomic context Genomic clones Description
ECSMl Hs.13957 1100 bp 103 aa confirmed with 5′RACE Genomic neighbour: Tropomyosin dbSTS G26129 and G28043 Chr. 19 Gene Map 98: Marker SGC33470, Marker stSG3414, IntervalD19S425D19S418
AC005945, AC005795(partial identity)
ECSM2 Hs.30089 1023 bp Identical to the full-length sequence in the “cDNA encoding novel polypeptide from human umbilical vein endothelial cell” patent (Shibayama et al. 1997) 205 aa Clear signal peptide (SignalP), two predicted transmembrane domains (TopPred2 and DAS) Transmembrane protein, possibly an adhesion molecule
983 bp
ECSM3 Hs.8135 1694 bp AW888224-MXRA4 Matrix remodelling–associated gene 4 (Walker et al. 2000) 3047 bp Genomic neighbour: endothelial specific Clq/MBL/SPA receptor (C1qRp, AA4, Ly68)—both genes contained within only 8 kb-region dbSTS G06859 Chr. 20, Gene Map 98: Marker sts-W72082, Interval D20S182D20S106 Endothelial specific gene involved in matrix remodelling, possibly a novel metalloproteinase or ECM protein Possible 26 bp regulatory sequence shared with the endothelial-specific gene endothelin-converting enzyme-1 (E = 3e–04): CTTCCTGAAGCCTTGCTCCCTCCACC Possible regulatory sequence shared with the endothelial specific mouse AA4 gene (ClqRp, Ly68) 3′UTR (E = 2e–24)
AL118508, AC011137, HSJ737E23, and AL118508.27 on the NCBI Map Viewer
Magic roundabout Hs.111518 2076 bp Partial cDNA FLJ20798 fis, clone ADSU02031 (acc. AK000805) 1496 bp 417 aa One transmembrane domain predicted by TopPred2 and DAS No signal peptide detected in the available 417 aa ORF (SignalP); however, the true protein product is very likely to be larger Genomic neighbour: integral transmembrane protein 1 (ITM1) dbSTSG14646 and G14937 Chr. 11, Gene Map 98: Marker SHGC11739, Interval D11S1353-D11S93 468 aa region of homology to the cytoplasmic portion of the roundabout axon guidance protein family: human ROBO1, rat ROBO1, and mouse dutt1 (E = 1.3e–0.9) ORF has no apparent upstream limit. This and size comparison to ROBO1 (1651 aa) suggest that true protein is very likely to be much larger Possible alternative polyA sites: the cDNA clone from adipocyte tissue seems to be polyadenylated in a different position to the sequence from the UniGene contig

This Article

  1. Genome Res. 10: 1796-1806

Preprint Server