Searching journal content for articles similar to Warner and Nierras 8 (5): 419.

Displaying results 1-10 of 131
For checked items
  1. Method: A HIT-trapping strategy for rapid generation of reversible and conditional alleles using a universal donor
    • Hengxing Lu,
    • Jun Liu,
    • Tao Feng,
    • Zihang Guo,
    • Yunjun Yin,
    • Fei Gao,
    • Gengsheng Cao,
    • Xuguang Du,
    • and Sen Wu
    Genome Res. May 2021 31: 900-909; Published in Advance April 1, 2021, doi:10.1101/gr.271312.120
    ...integration, the gene-trap cassette leads to the expression of a truncated protein and GFP by the promoter of the target gene. The selection cassette expresses a puromycin-resistance gene by a constitutive SV40 promoter. (ATS sequence) GGTATGTCGGGAACCTCTCCAGG; (SA) splice acceptor; (IRES) internal ribosome...
  2. Research: Cytosolic and mitochondrial translation elongation are coordinated through the molecular chaperone TRAP1 for the synthesis and import of mitochondrial proteins
    • Rosario Avolio,
    • Ilenia Agliarulo,
    • Daniela Criscuolo,
    • Daniela Sarnataro,
    • Margherita Auriemma,
    • Sabrina De Lella,
    • Sara Pennacchio,
    • Giovanni Calice,
    • Martin Y. Ng,
    • Carlotta Giorgi,
    • Paolo Pinton,
    • Barry S. Cooperman,
    • Matteo Landriscina,
    • Franca Esposito,
    • and Danilo Swann Matassa
    Genome Res. August 2023 33: 1242-1257; Published in Advance July 24, 2023, doi:10.1101/gr.277755.123
    ...alternatively as an oncogene or a tumor suppressor, but also plays a concomitant moonlighting function in mRNA translation regulation. Herein, we identify the molecular mechanisms involved, showing that TRAP1 (1) binds both mitochondrial and cytosolic ribosomes, as well as translation elongation factors; (2...
    OPEN ACCESS ARTICLE
  3. Letter: Exon-trapping mediated by the human retrotransposon SVA
    • Dustin C. Hancks,
    • Adam D. Ewing,
    • Jesse E. Chen,
    • Katsushi Tokunaga,
    • and Haig H. Kazazian, Jr
    Genome Res. November 2009 19: 1983-1991; Published in Advance July 27, 2009, doi:10.1101/gr.093153.109
    ...Exon-trapping mediated by the human retrotransposon SVA Dustin C. Hancks 1 , 3 , Adam D. Ewing 1 , 3 , Jesse E. Chen 1 , Katsushi Tokunaga 2 and Haig H. Kazazian, Jr 1 , 4 1 Department of Genetics, University...
  4. Method: Long-read subcellular fractionation and sequencing reveals the translational fate of full-length mRNA isoforms during neuronal differentiation
    • Alexander J. Ritter,
    • Jolene M. Draper,
    • Christopher Vollmers,
    • and Jeremy R. Sanford
    Genome Res. November 2024 34: 2000-2011; Published in Advance June 5, 2024, doi:10.1101/gr.279170.124
    ...et al. 2009). RNC-seq captures ribosome nascent-chain complex-bound mRNAs to characterize the translatome, but it does not provide ribosome footprints or ribosome density information (Wang et al. 2013). TRAP-seq utilizes epitope-tagged ribosomes to enable cell type–specific translation profiling...
    OPEN ACCESS ARTICLE
  5. LETTER: A novel view of the transcriptome revealed from gene trapping in mouse embryonic stem cells
    • Guglielmo Roma,
    • Gilda Cobellis,
    • Pamela Claudiani,
    • Francesco Maione,
    • Pedro Cruz,
    • Gaetano Tripoli,
    • Marco Sardiello,
    • Ivana Peluso,
    • and Elia Stupka
    Genome Res. July 2007 17: 1051-1060; Published in Advance May 31, 2007, doi:10.1101/gr.5720807
    ...A novel view of the transcriptome revealed from gene trapping in mouse embryonic stem cells Guglielmo Roma 1 , 4 , Gilda Cobellis 1 , 2 , 4 , Pamela Claudiani 1 , 4 , Francesco Maione 1 , Pedro Cruz 1 , Gaetano Tripoli 1...
  6. REVIEW: Protocols for trapping internal and 3'-terminal exons.
    • P E Nisson,
    • A Ally,
    • and P C Watkins
    Genome Res. August 1994 4: S24-S39
    ...Protocols for trapping internal and 3'-terminal exons. P E Nisson , A Ally , and P C Watkins Life Technologies, Inc., Gaithersburg, Maryland 20884-9980, USA. Abstract Footnotes Copyright © Cold Spring Harbor Laboratory Press...
  7. Method: Mapping and quantifying nascent transcript start sites using TT-TSS-seq
    • Eleanor Elgood Hunt,
    • Claudia Vivori,
    • Richard Mitter,
    • Vedis Agnadottir,
    • and Folkert J. van Werven
    Genome Res. March 2026 36: 600-610; Published in Advance February 17, 2026, doi:10.1101/gr.280726.125
    ...investigation into its underlying mechanisms (Thorsen et al. 2011; Demircioğlu et al. 2019).For mapping TSSs, sequencing approaches have been employed with different biochemical strategies to capture the 5′ ends of transcripts. Cap-trapping techniques, including Cap Analysis of Gene Expression (CAGE...
    OPEN ACCESS ARTICLE
  8. ARTICLE: Identification and Analysis of Over 2000 Ribosomal Protein Pseudogenes in the Human Genome
    • Zhaolei Zhang,
    • Paul Harrison,
    • and Mark Gerstein
    Genome Res. October 1, 2002 12: 1466-1482; doi:10.1101/gr.331902
    ...Identification and Analysis of Over 2000 Ribosomal Protein Pseudogenes in the Human Genome Zhaolei Zhang , Paul Harrison , and Mark Gerstein 1 Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, Connecticut 06520, USA...
  9. ARTICLE: Cloning of 559 potential exons of genes of human chromosome 21 by exon trapping.
    • H Chen,
    • R Chrast,
    • C Rossier,
    • M A Morris,
    • M D Lalioti,
    • and S E Antonarakis
    Genome Res. August 1996 6: 747-760; doi:10.1101/gr.6.8.747
    ...chromosome. A to- tal of 1194 cosmids were used. Pools of 10 cos- mids were used for each trapping experiment. In only a few experiments, all cosmids from a 96- microliter well plate were used. Clones that con- tained human ribosomal RNA (RNR) sequences and mouse genomic sequences were eliminated...
  10. RESEARCH: A Map of 75 Human Ribosomal Protein Genes
    • Naoya Kenmochi,
    • Tomoko Kawaguchi,
    • Steve Rozen,
    • Elizabeth Davis,
    • Nathan Goodman,
    • Thomas J. Hudson,
    • Tatsuo Tanaka,
    • and David C. Page
    Genome Res. May 1, 1998 8: 509-523; doi:10.1101/gr.8.5.509
    ...rise to processed pseudogenes. The methods we employed for STS generation via intron trapping should be of use in efforts to systematically map genes with a propensity to generate processed pseudogenes, that is, housekeeping and other genes that are abundantly expressed in the germ line. Ribosomal...
For checked items

Search Results

Next 10 » New Search

Modify Results

Citation format:
Results / page:
Results order:

This search

  • Alert me when new articles matching this search are published
  • Download all citations on this page to my citation manager

Preprint Server



Current Issue

  1. April 2026, 36 (4)
  1. Current Issue
  1. Alert me to new issues of Genome Research