Searching journal content for articles similar to Sharon et al. 24 (10): 1698.

Displaying results 1-10 of 106

For checked items

view abstracts
download to citation manager

Select this article
Review: A systematic guide for identifying transcription factors that directly regulate the expression of a gene of interest
- Andrew D. Bates,
- Dawid Grzela,
- Maciej Studzian,
- Louise Brennan,
- Moli Williams,
- Conor Fawcett,
- Beth Hammond,
- Manreen Grewal,
- Marcin Ratajewski,
- Lukasz Pulaski,
- and Urszula L. McClurg
Genome Res. March 2026 36: 433-459; Published in Advance February 17, 2026, doi:10.1101/gr.281154.125
...abundance and mapping initiation sites, crucial for identifying promoter regions and TF binding sites. However, RPA is technically demanding, requiring careful probe design and optimization to minimize background noise. Additionally, it is less suitable for high-throughput analysis.Historically microarrays...
OPEN ACCESS ARTICLE
Select this article
Research: Systematic interrogation of human promoters
- Shira Weingarten-Gabbay,
- Ronit Nir,
- Shai Lubliner,
- Eilon Sharon,
- Yael Kalma,
- Adina Weinberger,
- and Eran Segal
Genome Res. February 2019 29: 171-183; Published in Advance January 8, 2019, doi:10.1101/gr.236075.118
...,000 designed promoters from a fixed locus in the human To broaden our understanding of human promoters, we designed a library of 15,753 oligonucleotides representing native and synthetic sequences. We included 508 PIC binding regions and 1875 core promoters of coding genes from the human . In addition, we...
Select this article
Resource: The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements
- Stefan Schoenfelder,
- Mayra Furlan-Magaril,
- Borbala Mifsud,
- Filipe Tavares-Cadete,
- Robert Sugar,
- Biola-Maria Javierre,
- Takashi Nagano,
- Yulia Katsman,
- Moorthy Sakthidevi,
- Steven W. Wingett,
- Emilia Dimitrova,
- Andrew Dimond,
- Lucas B. Edelman,
- Sarah Elderkin,
- Kristina Tabbada,
- Elodie Darbo,
- Simon Andrews,
- Bram Herman,
- Andy Higgs,
- Emily LeProust,
- Cameron S. Osborne,
- Jennifer A. Mitchell,
- Nicholas M. Luscombe,
- and Peter Fraser
Genome Res. April 2015 25: 582-597; Published in Advance March 9, 2015, doi:10.1101/gr.185272.114
...control (Bulger andGroudine 2011). For example, developmental enhancers can be located at considerable genomic distances from the gene promoters they regulate, often bypassing several promoters located in the intervening DNA sequence to interact with their target genes (Carvajal et al. 2001; Carter et al...
OPEN ACCESS ARTICLE
Select this article
Research: Deep learning of the regulatory grammar of yeast 5′ untranslated regions from 500,000 random sequences
- Josh T. Cuperus,
- Benjamin Groves,
- Anna Kuchina,
- Alexander B. Rosenberg,
- Nebojsa Jojic,
- Stanley Fields,
- and Georg Seelig
Genome Res. December 2017 27: 2015-2024; Published in Advance November 2, 2017, doi:10.1101/gr.224964.117
...shorter than 50 bp. Twenty–base-pair overhangs were added to both 5′ (acattaggacctttgcagca) and 3′ (ATGacagagcagaaagccct) ends of these sequences, again overlapping the CYC1 promoter and HIS3 gene on the p415-pCYC1 plasmid. The library sequences were purchased from CustomArray Inc. as a mixed oligo pool...
Select this article
Method: Extending the spectrum of DNA sequences retrieved from ancient bones and teeth
- Isabelle Glocke and
- Matthias Meyer
Genome Res. July 2017 27: 1230-1237; Published in Advance April 13, 2017, doi:10.1101/gr.219675.116
...of library molecules generated from the control oligonucleotide was determined using a probe-based qPCR assay specific to successfully converted oligonucleotides. Note that no selection is necessary on the P7 adapter sequence, as molecules without P7 adapters lack the biotin required for bead binding...
Select this article
Research: Intragenic repeat expansion in the cell wall protein gene HPF1 controls yeast chronological aging
- Benjamin P. Barré,
- Johan Hallin,
- Jia-Xing Yue,
- Karl Persson,
- Ekaterina Mikhalev,
- Agurtzane Irizar,
- Sylvester Holt,
- Dawn Thompson,
- Mikael Molin,
- Jonas Warringer,
- and Gianni Liti
Genome Res. May 2020 30: 697-710; Published in Advance April 10, 2020, doi:10.1101/gr.253351.119
...) in HPF1 for NA and WA alleles. Hatched rectangle: a HPF1 internal unique region with high sequence variation between NA and WA alleles. Right: repeat motif units. Amino acids are colored according to the RasMol nomenclature. Numbers = motif size (amino acids). (B) Size variation of genes containing long...
OPEN ACCESS ARTICLE
Select this article
Method: HIT'nDRIVE: patient-specific multidriver gene prioritization for precision oncology
- Raunak Shrestha,
- Ermin Hodzic,
- Thomas Sauerwald,
- Phuong Dao,
- Kendric Wang,
- Jake Yeung,
- Shawn Anderson,
- Fabio Vandin,
- Gholamreza Haffari,
- Colin C. Collins,
- and S. Cenk Sahinalp
Genome Res. September 2017 27: 1573-1588; Published in Advance July 18, 2017, doi:10.1101/gr.221218.117
...Prioritizing molecular alterations that act as drivers of cancer remains a crucial bottleneck in therapeutic development. Here we introduce HIT’nDRIVE, a computational method that integrates genomic and transcriptomic data to identify a set of patient-specific, sequence-altered genes, with sufficient...
Select this article
Research: Large-scale mapping of gene regulatory logic reveals context-dependent repression by transcriptional activators
- David van Dijk,
- Eilon Sharon,
- Maya Lotan-Pompan,
- Adina Weinberger,
- Eran Segal,
- and Lucas B. Carey
Genome Res. January 2017 27: 87-94; Published in Advance December 13, 2016, doi:10.1101/gr.212316.116
...A, Segal E. 2012. Inferring gene regulatory logic from high-throughput measurements of thousands of systematically designed promoters. Nat Biotechnol 30: 521–530. ↵Sharon E, van Dijk D, Kalma Y, Keren L, Manor O, Yakhini Z, Segal E. 2014. Probing the effect of promoters on noise in gene expression...
Select this article
Research: High-throughput mapping of the promoters of the mouse olfactory receptor genes reveals a new type of mammalian promoter and provides insight into olfactory receptor gene regulation
- E. Josephine Clowney,
- Angeliki Magklara,
- Bradley M. Colquitt,
- Nidhi Pathak,
- Robert P. Lane,
- and Stavros Lomvardas
Genome Res. August 2011 21: 1249-1259; Published in Advance June 24, 2011, doi:10.1101/gr.120162.110
...chosen by Vega pseudogene designation or lack of nearby RefGene Olfr annotation. Mouse olfactory receptor promoters Genome Research 1251 www..org understand the evolutionary or regulatory significance of the use of promoter sequences with extreme AT content, we constructed a secondary promoter data set...
Select this article
Method: Mapping functional transcription factor networks from gene expression data
- Brian C. Haynes,
- Ezekiel J. Maier,
- Michael H. Kramer,
- Patricia I. Wang,
- Holly Brown,
- and Michael R. Brent
Genome Res. August 2013 23: 1319-1328; Published in Advance May 1, 2013, doi:10.1101/gr.150904.112
...devoted to mapping TF networks. In Saccharomyces cerevisiae, protein–DNA interactions have been identified for most TFs by ChIP-chip, and expression profiling has been done on strains deleted for most TFs. These studies revealed that there is little overlap between the genes whose promoters are bound...

For checked items

view abstracts
download to citation manager

Searching journal content for articles similar to Sharon et al. 24 (10): 1698.

Search Results

Modify Results

This search

Preprint Server

Current Issue

In This Issue

Citation format:
Results / page:
Results order: