Searching journal content for articles similar to Brusic et al. 13 (6b): 1307.

Displaying results 1-10 of 5923

For checked items

view abstracts
download to citation manager

Select this article
Method: De novo antibody identification in human blood from full-length single B cell transcriptomics and matching haplotype-resolved germline assemblies
- John Beaulaurier,
- Lynn Ly,
- J. Andrew Duty,
- Carly Tyer,
- Christian Stevens,
- Chuan-Tien Hung,
- Akash Sookdeo,
- Alex W. Drong,
- Shreyas Kowdle,
- Axel Guzman-Solis,
- Domenico Tortorella,
- Daniel J. Turner,
- Sissel Juul,
- Scott Hickey,
- and Benhur Lee
Genome Res. April 2025 35: 929-941; Published in Advance March 21, 2025, doi:10.1101/gr.279392.124
...Sorted B cells in the ASC and MBC gates were separately processed for single-cell RNA-seq using the Chromium Next GEM Single-Cell 3′ Reagent kits v3.1 (10x Genomics) according to the manufacturer instructions with modifications: After the GEM-RT cleanup and full-length cDNA amplification step, 50% of the cDNA...
OPEN ACCESS ARTICLE
Select this article
Resource: Full-length RNA transcript sequencing traces brain isoform diversity in house mouse natural populations
- Wenyu Zhang,
- Anja Guenther,
- Yuanxiao Gao,
- Kristian Ullrich,
- Bruno Huettel,
- Aftab Ahmad,
- Lei Duan,
- Kaizong Wei,
- and Diethard Tautz
Genome Res. November 2024 34: 2118-2132; Published in Advance September 17, 2024, doi:10.1101/gr.279166.124
...′ GTACTCTGCGTTGATACCACTGCTT). The two cDNA primer sets differ only in the 5′ end, while the segments for the 3′ end are the same. TeloPrime-based kit V2 includes updated reaction conditions in comparison with kit V1, while the method of cDNA generation remains unchanged. For each protocol, we used 1 μg homogeneous RNA...
Select this article
Method: Long-read subcellular fractionation and sequencing reveals the translational fate of full-length mRNA isoforms during neuronal differentiation
- Alexander J. Ritter,
- Jolene M. Draper,
- Christopher Vollmers,
- and Jeremy R. Sanford
Genome Res. November 2024 34: 2000-2011; Published in Advance June 5, 2024, doi:10.1101/gr.279170.124
...using HiSeq 4000 PE150 (50 million to 100 million reads per library).Long-read Frac-seqFrom the same fractionated mRNA used prior for Illumina sequencing, full-length cDNA was prepared using the rolling circle amplification to concatemeric consensus (R2C2) method (Volden et al. 2018). Libraries were...
OPEN ACCESS ARTICLE
Select this article
Method: Quantifying full-length circular RNAs in cancer
- Ken Hung-On Yu,
- Christina Huan Shi,
- Bo Wang,
- Savio Ho-Chit Chow,
- Grace Tin-Yun Chung,
- Raymond Wai-Ming Lung,
- Ke-En Tan,
- Yat-Yuen Lim,
- Anna Chi-Man Tsang,
- Kwok-Wai Lo,
- and Kevin Y. Yip
Genome Res. December 2021 31: 2340-2353; Published in Advance October 18, 2021, doi:10.1101/gr.275348.121
...in quantifying expression levels. First, we used the data set of human fetal samples mentioned above, which also included the expression levels of some BSJs independently measured by RT-qPCR (Szabo et al. 2015). We applied psirc to deduce the expression level of each full-length circRNA isoform using the RNA...
Select this article
Resource: Recent, full-length gene retrocopies are common in canids
- Kevin Batcher,
- Scarlett Varney,
- Daniel York,
- Matthew Blacksmith,
- Jeffrey M. Kidd,
- Robert Rebhun,
- Peter Dickinson,
- and Danika Bannasch
Genome Res. August 2022 32: 1602-1611; Published in Advance August 12, 2022, doi:10.1101/gr.276828.122
...landscape of canid retroCNVs has not been characterized. Here, retroCNV discovery was performed on a whole- sequencing data set of 293 canids from 76 breeds. We identified retroCNV parent genes via the presence of mRNA-specific 30-mers, and then identified retroCNV insertion sites through discordant read...
Select this article
Method: Marker-free characterization of full-length transcriptomes of single live circulating tumor cells
- Sarita Poonia,
- Anurag Goel,
- Smriti Chawla,
- Namrata Bhattacharya,
- Priyadarshini Rai,
- Yi Fang Lee,
- Yoon Sim Yap,
- Jay West,
- Ali Asgar Bhagat,
- Juhi Tayal,
- Anurag Mehta,
- Gaurav Ahuja,
- Angshul Majumdar,
- Naveen Ramalingam,
- and Debarka Sengupta
Genome Res. January 2023 33: 80-95; Published in Advance November 22, 2022, doi:10.1101/gr.276600.122
...) on the Polaris IFC and single CTO+ & Calcein AM+ & PTPRC− & CD31− cells were selected to capture sites. Finally, single-cell processing was achieved through template-switching mRNA-seq chemistry for full-length cDNA generation and preamplification on IFC. Supplemental Note 5 elaborates the steps involved in m...
Select this article
Method: Complete characterization of the human immune cell transcriptome using accurate full-length cDNA sequencing
- Charles Cole,
- Ashley Byrne,
- Matthew Adams,
- Roger Volden,
- and Christopher Vollmers
Genome Res. April 2020 30: 589-601; Published in Advance April 20, 2020, doi:10.1101/gr.257188.119
...,000,000 full-length cDNA sequences at a median accuracy of 97.9% using our nanopore sequencing-based Rolling Circle Amplification to Concatemeric Consensus (R2C2) protocol. We used this data set to (1) show that deep and accurate full-length cDNA sequencing can be used to provide isoform-level transcriptome...
Select this article
Resource: The full-length transcriptome of C. elegans using direct RNA sequencing
- Nathan P. Roach,
- Norah Sadowski,
- Amelia F. Alessi,
- Winston Timp,
- James Taylor,
- and John K. Kim
Genome Res. February 2020 30: 299-312; Published in Advance February 5, 2020, doi:10.1101/gr.251314.119
...used high-throughput cDNA sequencing technologies. For example, in the annotation of the Caenorhabditis elegans transcriptome, more than half of the transcript isoforms lack full-length support and instead rely on inference from short reads that do not span the full length of the isoform. We applied...
OPEN ACCESS ARTICLE
Select this article
Resource: Direct full-length RNA sequencing reveals unexpected transcriptome complexity during Caenorhabditis elegans development
- Runsheng Li,
- Xiaoliang Ren,
- Qiutao Ding,
- Yu Bi,
- Dongying Xie,
- and Zhongying Zhao
Genome Res. February 2020 30: 287-298; Published in Advance February 5, 2020, doi:10.1101/gr.251512.119
..., full-length cDNAs, and RNA sequencing (RNA-seq) of cDNA fragments using massively parallel sequencing (Reboul et al. 2003; Ramani et al. 2011; Uyar et al. 2012; Grün et al. 2014; Boeck et al. 2016; Tourasse et al. 2017). Short RNA-seq reads, typically shorter than 200 nt, have played a leading role...
Select this article
Method: Direct RNA nanopore sequencing of full-length coronavirus genomes provides novel insights into structural variants and enables modification analysis
- Adrian Viehweger,
- Sebastian Krautwurst,
- Kevin Lamkiewicz,
- Ramakanth Madhugiri,
- John Ziebuhr,
- Martin Hölzer,
- and Manja Marz
Genome Res. September 2019 29: 1545-1554; Published in Advance August 22, 2019, doi:10.1101/gr.247064.118
...). Comparative DRS analyses of RNA obtained from cells infected with (1) plaque-purified HCoV-229E and (2) newly rescued recombinant HCoV-229E (without prior plaque purification), respectively, would help to address the possible role of prematurely terminated in vitro transcripts produced from full-length cDNA...

For checked items

view abstracts
download to citation manager

Searching journal content for articles similar to Brusic et al. 13 (6b): 1307.

Search Results

Modify Results

This search

Preprint Server

Current Issue

In This Issue

Citation format:
Results / page:
Results order: