Analysis of the Potential Sites for α2–Mcm1-Mediated Repression
| ORF | Gene | bp | Sequence | mRNA | Repression | Activation |
| mis = 0 | ||||||
| YDR461W | MFA1 | 204 | TGTAA TTACCCAAAAAGGAAATTTACA | a | 100× | 15× |
| YFL026W | STE2 | 201 | TGTAAATTTCCTAATTGGGTAAGTACA | a | 33× | 28× |
| YGL032C | AGA2 | 271 | TGTAATTTCCGAATACGGTAATTACA | a | 167× | 51× |
| YIL015W | BAR1 | 237 | TGTAATTACCGTAAAAGGAAATTACA | a | 81× | 25× |
| YKL209C | STE6 | 184 | TGTAATTACCTAATAGGGAAATTTACA | a | 69× | 17× |
| YNL145W | MFA2 | 223 | TGTATTTACCTATTCGGGAAATTTACA | a | 43× | 47× |
| mis = 1 | ||||||
| DPS1 | TGTAATTACTGTATTGGGAAATTTACA | a | 404× | 7.8× | ||
| YJL170C | ASG7 | 205 | TGTAAATTTCCCGATGCGGTAATTACG | a | 13× | 14× |
| YJL169W | ORF | 166 | a, α, a/α | |||
| YKL188C | PXA2 | 259 | TGTAATTAACGCCGAAGGAATATACA | a, α, a/α | 1.3× | 1.5× |
| YMR219W | ESC1 | 29 | TGTAAATTCACCAAGGGGTTAAGTACA | a, α, a/α | 1.1× | 1.2× |
| YMR218C | ORF | 191 | a, α, a/α | |||
| mis = 2 | ||||||
| DPS2 | TGTAATTACTTAAATAGGAAGTTTACA | a | 283× | 12× | ||
| YLR432W | ORF | 405 | TGTTCATTTCTAACTCTGGTTAATTACA | a, α, a/α | 2.4× | 0.9× |
| YGL187C | COX4 | 324 | TGTATTTTTCAATAAGAGGATTATAACA | a, α, a/α | 2.8× | 1.0× |
| YNL053W | MSG5 | 249 | TGTACTTTCCAAAAAAGGAAAATGTA | a, α, a/α | 0.5× | 22× |
| YGL075C | ORF | 344 | TGTCATATACCCGTGAAGGCATTTACA | a, α, a/α | 1.3× | 0.9× |
| YJL062W | ORF | 162 | TATAGATATGCTTATACGGATATATACA | a, α, a/α | 2.3× | 1.0× |
| YJR138W | ORF | 645 | TGTACAATACCATCAATGGCTTCTAAA | a, α, a/α | 2.6× | 1.4× |
-
↵mRNA was examined by Northern blot or RT–PCR in the previous studies and this work. (a) The transcript is only present in a cells. a, α, a/α) The RNA was present at the same level in haploid a, α, and diploida/α cells, respectively. The α2–Mcm1 sites that are involved in mating-type switching, DPS1 and DPS2,regulate cell-specific expression of several small transcripts (Szeto et al. 1997).
-
↵The fold repression is measured assaying the level of expression of a CYC1–lacZ reporter plasmid containing the designated α2/Mcm1-binding site and comparing it to the parent vector without the site (212 units) in a MATα strain.
-
↵The fold activation is measured assaying the level of expression of a CYC1–lacZ reporter plasmid with the designated α2/Mcm1-binding site lacking the CYC1 UAS sites and comparing it to the parent vector without the Mcm1 site (0.4 units) in a MAT a strain.











