Figure 2.
179I15–H. sapiens chromosome 13 BRCA2 region. (A) After finishing, 179I15 contained a region of 11 bp within a CpG island in which the sequence was unreadable using standard dye primer or dye terminator sequencing. (B) An example of a reverse direction dye primer terminator sequencing reaction over the region (read no. 3284); the sequence obtained from a small insert clone across the same region (read no. 4052). EMBL accession no. Z92540, bases 13000–131140. Sequence starts, CCTGCACGGCTCCCGGGAGCTGGGAGAAA; sequence ends, GTGAGTGCGAGGGGCCAGGCGGAGGGCCA.
