Errata for vol. 7, p. 17

Genome Research 7: 17–26 (1997)

A Region of Mouse Chromosome 16 Is Syntenic to the DiGeorge, Velocardiofacial Syndrome Minimal Critical Region Naomi Galili, H. Scott Baldwin, Jim Lund, Roger Reeves, Weilong Gong, Zhili Wang, Bruce A. Roe, Beverly S. Emanuel, Sudhir Nayak, Craig Mickanin, Marcia L. Budarf, and Clayton A. Buck

An incorrect forward primer sequence was given for the first set of primers used in the RT-PCR of the Gsc1 gene. The correct set should read

1. FATGGCGACTGCAGGCAGCGCGGCC  RCTTGTGCTCTACTTCATAAAGCCAGATAAACT

Footnotes

| Table of Contents

Preprint Server