SAGE-Seq tag alignment and sequencing error minimization. (A) Best tag is defined as the tag next to the 3′-most NlaIII site (CATG) to the poly(A) tail. (B) Tag alignment statistics of sample N1 according to the tag alignment pipeline in Supplemental Figure S3. Detailed mapping of other data sets is shown in Supplemental spreadsheet 1. (C) Presumed sequencing errors revealed during tag mapping. All of the listed tags are best tags uniquely mapped to the same RefSeq gene “NM_001010.” (Not every tag uniquely mapped to this gene at the same location is listed.) X-axis is the tag sequences listed in descending order of tag count. The one-base difference in sequence most likely due to sequencing error is marked in red. Sequencing error minimization step for this particular example is done in the following way: sum up the count of all these tags and assign it to tag “CATGGCCGTGTCCGCCTGCTA” and remove all the other tags.
