Xenopus tropicalis microRNAs
Click on table to view larger version.

aNew miRNAs species identified in this study.
bPotentially different annotation if seed sequence conservation is considered. xtr-let-7b [UGAGGUAGUAGUUUGUGUAGU] could be xtr-let-7g; xtr-let-7e [UGAGGUAGUAGGUUGUUUAGUU] could be xtr-let-7a.
cSequence [UUGUGUGGAAAUGCUUCUAU] is predicted to be xtr-mir-147; accession number is pending experimental validation.
dSequence [ACCAUCGGCCGUUGACUGUACC]is temporally designated as pre-miRNA xtr-mir-181a-2*; accession number not assigned.











