Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation

Click on image to view larger version.

Table 1.

Xenopus tropicalis microRNAs

Click on table to view larger version.

Table 1.

aNew miRNAs species identified in this study.

bPotentially different annotation if seed sequence conservation is considered. xtr-let-7b [UGAGGUAGUAGUUUGUGUAGU] could be xtr-let-7g; xtr-let-7e [UGAGGUAGUAGGUUGUUUAGUU] could be xtr-let-7a.

cSequence [UUGUGUGGAAAUGCUUCUAU] is predicted to be xtr-mir-147; accession number is pending experimental validation.

dSequence [ACCAUCGGCCGUUGACUGUACC]is temporally designated as pre-miRNA xtr-mir-181a-2*; accession number not assigned.

This Article

  1. Published in Advance November 21, 2007, doi: 10.1101/gr.6539108 Genome Res. 18: 104-112

Preprint Server



Current Issue

  1. January 2026, 36 (1)
  1. Current Issue
  1. Alert me to new issues of Genome Research