
RT–PCRs showing the presence of chimeric transcript. (A) A diagram of the 2329-nt-long CDC2L2 β sv 13 isoform with the 67-nt UTR at the 5′ end and the downstream coding region. (B) The presence of a chimeric transcript: a product of the expected size is seen by RT–PCR in testis (T) but not in the brain (B); (Primers: Forward- GAATTCCATTCCATTCCA, Reverse GTTCGGTGATGTGCAGAC). (Lanes 5,6) Amplification of CDC2L2 in both testis and brain using primers to exons common to both the isoforms (Forward- CCCAAGTACCTGCCGGCCCTG, Reverse- AGCCCTCCTTCTCCTTCTCCATCT). (–) Negative control. (C) Amplification of the 67-nt UTR from testis (T) but not from brain tissue (B) (Primers: Forward- GAATTCCATTCCATTCCA, Reverse- GCAGTAGAAGAGAATAGA). (M) The marker lanes. RT–PCR using GAPDH primers as loading controls is given below the corresponding lanes. (D) The results of the reporter assay. pGL3 promoter containing the 67-nt UTR shows a ∼1.88-fold enhancement of luciferase activity when compared with the promoter vector alone. Standard deviations are indicated by the bars on the histograms. (E) The Southern blots of normal male and female DNAs digested with Pst1 and EcoR1 and probed with CDC2L2. Comparison with the β-actin control shows that there is no copy number difference between the male and female DNAs, thereby confirming the presence of the gene on an autosome. (F) The standard plot and amplification plots of CDC2L2 [blue] (Primers: Forward- CCCAAGTACCTGCCGGCCCTG, Reverse- AGCCCTCCTTCTCCTTCTC CATCT) and GAPDH [purple] (Primers: Forward- ACGGGAAGCTCACTGGCATGG, Reverse- CAACAGC GACACCCACTCCTC) using DNA from XO, XX, XY, and XYY individuals. These clearly show that there is no copy number difference with increasing copies of Y chromosome in CDC2L2 and GAPDH. Therefore, there is no copy of CDC2L2 on the Y chromosome.











