
Testis-specific expression of the genomic clone AY598345 and the cDNAs (AY598346, AY598347) and their localization to Yq12. (A,B,C, top) Arrows indicate the brightly fluorescing, distal heterochromatic blocks on the Y. (A,B,C, middle) Localization of the genomic and the cDNA clones to the heterochromatic blocks. (Insets, bottom) Signals on Yq12 from three more metaphases for each of the clones (Bars, 5 μm). (D,E,F) A testis-specific expression of the genomic and the cDNA clones on multi-tissue RNA blots. Large heterogeneously sized transcripts are observed for all of the clones. (D) A smear ranging from ∼9.5 to 1 kb. (E) A smear ranging from about 8 to 1.2 kb, with AY598346; (F) a smear ranging from about 20 to 1.2 kb, with the AY598347 probe. Corresponding β-actin controls are given below. (G) The results of the RT–PCR for the AK128024 (obtained from NCBI database, Primers: Forward- TCCTTTCGAGCCCTTTCAATTTG, Reverse- ATGCCCTTGAATTAAATGGACTG), and AK47, obtained by merger of AK128024 and our cDNA AY598347 (Forward- TCCTTTCGAGCCCTTTCAATTTG, Reverse- TGGAACAGAGAGCAATGGTATAG).











