Table 1.
Introns of ser-tRNACAG and ser-tRNACGA From theCandida spp.
| Anticodon of tRNA | Candidaspecies | Source | Intron |
| Ser(CAG) | C. tropicalis | GenBank accession no.D17535 | tttattctgggat |
| Ser(CAG) | C. lusitaniae | GenBank accession no. D17534 | tttatcagcacc- |
| Ser(CAG) | C. melibiosica | Ohama et al. 1993 | ttacacagcacc- **::::::::::- |
| Ser(CAG) | C. maltosa | GenBank accession no.D26074 | tttttcgtggtaaacgaaggtcaac |
| Ser(CAG) | C. cylindracea | Yokogawa et al. 1992 | atcttcattctcgac |
| Ser(CGA) | C. albicans | Ueda et al. 1994 | -tctt-attcgcgtt |
| Ser(CGA) | C. guilliermondii | Ueda et al. 1994 | -tctt-tt-gagtt -*** *-:**:::*:: |
| Ser(CGA) | C. zeylanoides | Ueda et al. 1994 | taaatttgagta |
-
Introns that display similarity were aligned. Bold type indicates identical nucleotides. Symbols displayed below the aligned sequences summarize the alignment: (*) a conserved nucleotide, (:) a nucleotide that is identical with one exception, (.) a position that has two identical nucleotides, and (-) a position with no identical nucleotides.
