Tandem Repeats >300 bp in 10q11
| Position in 10p11 sequence | Shortest high scoring periodicity | No. of repeats | % matches | % indels | Consensus length of other periodicities | Repeat sequ repeat na |
| (1-25435) | 5bp | 1001.4 | 70 | 0 | 10bp/26/98bp | GGAAT Sate |
| (168190-170696) | 5bp | 487.8 | 66 | 21 | 13bp/18/23bp | CATTT |
| (207701-285997) | 5bp | 1000.4 | 53 | 15 | 10bp/15bp etc. | GGAAT Sate |
| 1-46495 | 5bp | 995.8 | 69 | 4 | 10bp/15bp etc. | GGAAT Sate |
| 79169-80644 | 49bp | 30.3 | 92 | 1 | — | |
| 170593-170958 | 121bp | 3 | 87 | 2 | — |
-
Tandem repeats were identified with Tandem Repeat Finder using both stringent and relaxed search parameters (Benson 1999). Because repeat arrays are not homogeneous, a number of details are shown. The position in the sequence (column 1) indicates the extent of the entire array. The No. of repeats, % match, and % indels (columns 3–5) refer to the region defined by the shortest high scoring periodicity and not the entire array. Significant higher order periodicities are also shown, with the highest scoring periodicity being underlined and embolden. The 121bp repeat includes a 36bp Alu fragment. The sequence of the 49bp repeat is: GGCCGGTGTGAGGCAAGGGGCTCACGCTGACCTCTGTCAGCGT GGGAGG.
