
A duplex haplotype analysis of two SNPs lying 10 kb apart. For SNP rs510769, primer TATGGCATTTCACATTCACATGptTA was used; for SNP rs607759 of the OPRM1 gene primer, AATTGAATGGCTCTAGGptAC was used. Respective products for rs510769 were Gpt-TApt(G/A) with masses 1256 Da and 1240 Da, and respective products for rs607759 were GptAC(T/C) with masses 1216 and 1201. Top trace: The mass spectrometry analysis of SNPs rs510769 and rs607759 of the OPRM1 gene in a specific fosmid pool. As can be deduced from the masses, the A allele of SNP rs510769 and the T allele of SNP rs607759 were in phase. Bottom trace: The analysis of the complementary fosmid pool, where the G allele of SNP rs510769 and the C allele of SNP rs607759 were in phase.











