Minimal Introns Are Not “Junk”

Table 1.

Insertion-deletion (indel) polymorphism summary

L(intron) dL f(minor) GC(gene) GC(intron) Primates intron sequence
73 1 0.033 0.387 0.164 95–99% gtaatttaaaacttaaaattatttatttgattgtatttttattcatgtgctt aaagaattttTcttttttgtag
80 1 0.054 0.595 0.787 N/A gtgagtcccagggtggggctggggaccgtgggacGggggggggtcccagccc tgccctcacgcccaccccaccgcccccag
81 1 0.034 0.595 0.778 N/A gtggggcggggcccaggcggggaGgggggcccacgcagcggagcagccccaa catcccgcggccatctcccacccccaacag
90 1 0.022 0.595 0.700 N/A gtgagtgggcaggacaggggcctggggtaggggacagcaagtgaCccccccc tccacagcccagtctgacccaccccttccgtggccgcag
101 −3 0.011 0.361 0.317 88–100% gtaagaaagcaggtgtctgcaaaaagtcatgtatcgatttattgtttgtaat gatacAGTagtatagcagataactaagacatattttcttgaatttgcag
120 −3 0.021 0.516 0.292 100% gtattttgtcactcttgaaagtttttattgggtaagaggttcatgccctttg
−4 0.010  tcctcattttTTCttcttgttattttatcTTTAtttaCTTTTtccacttca
−5 0.010  tgTtttttttcctttag
−1 0.010
125 −1 0.021 0.411 0.376 92–98% gtaaatgTtctcctctttgttcaactcttaagtttcacatccagaagtttcat acactgacaagttgtggctttgatctggtttttgcgtaaccttaaatatga ctttttttttccccaccccag
79 −2 0.354 0.374 0.234 100% gtagtaaattacttaaattcaatttttccttgaaatAAgtgtgattagtaac ccattattatttcctttttattttcag
81 −1 0.375 0.516 0.370 100% gtaggaagagtgggagttttgcaaatggacaacTtaaagatggggaagaga atcaaactacacttttttccttttttctag
  • From left to right, we list the intron size, the size change with respect to the major allele, the minor allele frequency, the gene level GC content, the intron level GC content, the degree of conservation relative to their primate orthologs, and lastly, the intron sequence itself with the indel in uppercase. A total of 42 polymorphic sites were identified. There were 30 single-base substitutions and 12 indels, at normalized rates of θ(subst) = 6.75 × 10−4 and θ(indel) = 2.70 × 10−4.

This Article

  1. Genome Res. 12: 1185-1189

Preprint Server