Multiplex Three-Dimensional Brain Gene Expression Mapping in a Mouse Model of Parkinson's Disease

Table 2.

Potential Regulatory Sequences in Coregulated Genes

Gene pair Homology Blocks
SIAT9 t[ttgatatgt] cacttgattgggaaaf(26/26) ccttt[gccaatacaatgca]gcaaatgctt (29/29)
(6 exons) (689 bp 3′ downstream exon 2) (4358 bp 3′ downstream stop codon)
HIVEP2+ t[ttgatatat] caattgattaggaaac(23/26) cctct[gccaatcacatgca] gcaaatgctt(25/29)
(6 exons) (8331 bp 5′ upstream start codon) (7558 bp 3′ downstream stop codon)
HIVEP2 ttttta{(t[ttcatctga) c] a} a(19/19) gataattttacttggtattt[ctttttcttga] (31/31)
(6 exons) (16087 bp 5′ upstream start codon) (823 bp 3′ downstream exon 3)
SEPP1+ tttttc({t[ttcatctga) c] a} a(18/19) gattatttcattttgttttt[ctttttcttga] (26/31)
(5 exons) (16520 bp 5′ upstream start codon) (3784 bp 3′ downstream stop codon)
HIVEP2 [agaaaatctcttccttttaa] atttct(26/26) [atgaa] agctctcagtatattggc(23/23) [tttttttttttt] gcttgtaaaa(22/22)
(6 exons) (7281 bp 5′ upstream start codon) (802 bp 5′ upstream start codon) (17498 bp 3′ downstream stop codon)
NEFL mm+ [agaaaatcttttcctattaa] aattct(23/26) [atgaa] ggctctcagtgtattggc(21/23) [tttttttttttt] tcttctaaaa(20/22)
(4 exons) (19520 bp 5′ upstream start codon) (1611 bp 3′ downstream stop codon) (9527 bp 5′ upstream start codon)
HIVEP2 aa[aaagaatgaatctgttttaa] (22/22)
(6 exons) (17972 bp 3′ downstream stop codon)
SCYD1+ aa[aaaaaacgaatctgttttaa] (20/22)
(3 exons) (1816 bp 3′ downstream exon 1)
SEPP1 gaatctgcaaa[gcctttcct] (20/20) [cttctgtttactctca] ctct(20/20)
(5 exons) (15110 bp 5′ upstream start codon) (14403 bp 5′ upstream start codon)
SCYD1+ gaaactgtaaa[gcctttcct] (18/20) [cttcttgttactctca] ctct(18/20)
(3 exons) (9285 bp 3′ downstream stop codon) (19725 bp 3′ downstream stop codon)
SCYD1 atgcata[aatatttacatata] t(22/22) aaattttcttctgcttagct (20/20)
(3 exons) (5003 bp 3′ downstream 3′ exon 1) (5235 bp 3′ downstream exon 1)
NEFL+ atgcata[tatattcacatata] t(20/22) aaatttttttctgcttagct (19/20)
(4 exons) (13633 bp 3′ downstream stop codon) (6321 bp 5′ upstream start codon)
CUGBP2 at[ggaaaatgcaaagg] agaaaacag(25/25) gcccccct[aggagaggcaggtg] ctgc(26/26)
(13 exons) (65490 bp 3′ downstream exon 1) (89115 bp 3′ downstream exon 1)
MBP+ at[ggaaaaagcaaagg] agaaatcag(23/25) gcccacca[aggagaggcagggg] ctgc(23/26)
(7 exons) (33 bp 3′ downstream exon 1) (17744 bp 5′ upstream)
MBP atgcaaa[tacataaaat] aa(19/19) tcagtaacatttat[tttaacaactt] (25/25)
(7 exons) (10021 bp 5′ upstream start codon) (6019 bp 3′ downstream stop codon)
CBLN1+ atgtaaa[tacataaaat] aa(18/19) tcattaaaatttat[tttaaaaactt] (22/25)
(3 exons) (12012 bp 5′ upstream start codon) (9085 bp 5′ upstream start codon)
MBP catgtttgcagtggagt (17/17) tttcttt[cttgctttctgg] (19/19)
(7 exons) (1122 bp 5′ upstream exon 6) (3434 bp 3′ downstream end of exon 6)
NEFL− catgtttgcagtggagt (17/17) tttcttt[ctagctttctgg] (18/19)
(4 exons) (1045 bp 3′ downstream codon) (623 bp 5′ upstream start codon)
NEFL t[gttgt{tgttgtt] u gtttt} g(19/19) gatac[tttcaaagcatctgg] (20/20)
(4 exons) (17091 bp 5′ upstream start codon) (5611 bp 5′ upstream start codon)
CBLN1− t[gttgt{tgttgtt] u gttt} g(19/19) gattc[tttcaaagcatctgg] (19/20)
(3 exons) (461 bp 3′ downstream stop codon) (18945 bp 5′ upstream start codon)
NEFL a{(a[aaaaaaaaaaaa] ) a} aaagcacttca(26/26) aa[t(aaataaataaat) aa ] bb,cc gtcc(19/19)
(4 exons) (9536 bp 5′ upstream start codon) (4175 bp 3′ downstream stop codon)
PNUTL2 nn a{(a[aaaaaaaaaaaa] ) a} agagagcttca(23/26) aa[t(aaataaataaat) aa ] bb,cc ttcc(18/19)
(13 exons) (15553 bp 5′ upstream start codon) (2140 bp 3′ downstream exon 5)
NEFL atctttgttagtt[tttttttttttt] t(26/26) gaggttttggtagcattct (1919)
(4 exons) (9120 bp 5′ upstream start codon) (412 bp 3′ downstream exon 3)
USP9X− atctttgttagga[tttttttttttt] t(24/26) gaggatttggtagcattct (18/19)
(44 exons) (963 bp 3′ downstream exon 22) (1737 bp 5′ upstream start codon)
NEFL aaacaaaa[aaaagaaaaaaat] dd tatttt(27/27)
(4 exons) (745 bp 3′ downstream exon 1)
INA+ aaagaaag[aaaagaaaaaaat] dd tagttt(24/27)
(3 exons) (12338 bp 5′ upstream start codon)
CBLN1 tagactacactccaaaattt[ggacattc] ee(28/28) ttttggtga[aagttaagatattt] ff c(25/25) g[gc(c{ctcatctgca} gg g) hh g] ii c(17/17)
(3 exons) (10346 bp 5′ upstream start codon) (4822 bp 5′ upstream start codon) (6168 bp 3′ downstream stop codon)
USP9X+ tagactacacttcaaaagta[ggatattc] ee(24/28) tttttggtgt[aatttaagaaattt] ff c(22/25) g[gc(c{ctcatctgca} gg g) hh g] ii c(17/17)
(44 exons) (3010 bp 3′ downstream exon 34) (4799 bp 3′ downstream stop codon) (18415 bp 3′ downstream stop codon)
[ctttgttttt] jj gttttttttgg(22/22)
(8167 bp 3′ downstream stop codon)
[ctttgttttt] jj gctttttattgg(20/22)
(13160 bp 3′ downstream stop codon)
USP9X ttttttg(tttttt[t{ttttt) kk } ll(23/23)
(44 exons) (1572 bp 3′ downstream exon 11)
PNUTL2+ tttgttt(tttttt[t{ttttt) cctg] kk } ll(21/23)
(13 exons) (625 bp 5′ upstream start codon)
  • (+) correlated pair, (−) anti-correlated pair.

  • Nucleotide matches shown in parentheses, mismatches in bold. Potential binding sites (core in capitals).

  • LMO2COM ttGATAtat.

  • OCT1 gccaatcacATGCa.

  • GATA2 & GATA3 tcaGATGaaa(anti-sense strand).

  • MYOD ttCATCgac.

  • LMO2COMtgtCAGAtgaaa (anti-sense strand).

  • NFAT ntcaaGAAAaag (anti-sense strand).

  • GFI1 nnnnagaaAATCttttcctattaa.

  • TCF11 TTCAtnnnnnnnn (anti-sense strand).

  • HFH2 tttTTTTttttt.

  • GFI1 aaagaatgAATCtgttttaannnn.

  • NFAT nnnagGAAAggc (anti-sense strand).

  • FREAC2 tgagagTAAAcagaag (anti-sense strand).

  • ICT1 tatattcacATATa.

  • GKLF ggaaaaagcaAAGG.

  • GKLF aggagaggcaGGGG.

  • TATA taCATAAAAt.

  • SRY tttaACAActtn.

  • TH1E47 cttgctttCTGGnnnn.uSRYaacaACAAcaac anti-sense strand).

  • HFH2 tgtTGTTgtttt.

  • BARBIE tttcAAAGcatctgg.

  • HFH2 tttTTTTttttt (anti-sense strand).

  • HFH3 tttTTTTtttttt (anti-sense strand).

  • HNF3B tttttTTTTtttttt (anti-sense strand).

  • aaHFH2 attTATTtattt (anti-sense strand).

  • bb,ccHFH8 & HFH3 attTATTtattta (anti-sense strand).

  • ddHFH-3 attTTTTtctttt (anti-sense strand).

  • eeGATA gGATATtcnnn.

  • ffCEBPB aatttaaGAAAttt.

  • ggMYOD ctCATCtgca.

  • hhLMO2COM ctgCAGAtgagg (anti-sense strand).

  • iiE47 cctGCAGatgagggc (anti-sense strand).

  • jjSRY aaaaACAAagnn (anti-sense strand).

  • kkNFAT nncagGAAAaaa (anti-sense strand).

  • llCETS1P54 ncAGGAaaaa (anti-sense strand).

  • mmhuman NEFL = mouse Nfl.

  • nnhuman PNUTL2 = mouse Sept4.

  • No known transcription factor binding site.

This Article

  1. Genome Res. 12: 868-884

Preprint Server