Table 2.
Selected List of Repetitive Elements in the Thermoanaerobacter tengcongensis Genome
| Repeat ID | Length (bp) | Number of copies | Identity (%) | Short noncoding repeats | |
| TSR001 | 30 | 305 (67/238) | 100 | TSR001a(GTTTTTAGCCTACCTAAAAGGGATTGAAAC) | |
| TSR001b(GTTTTTAGCCTACCTAAGAGGGATTGAAAC) | |||||
| TSR027 | −250 | 18 | <87 | ||
| Copies | |||||
| Complete | Partial | Long coding repeats | |||
| TLR028 | 3565 | 4 | 5 | >99 | Transposase + hypothetical protein + transposase |
| TLR393 | 3045 | 2 | 1 | >98 | ABC transporters + hypothetical protein |
| TLR315 | 2603 | 2 | >94 | ABC transporters + permease component + conserved hypothetical protein | |
| TLR408 | 2490 | 2 | >98 | Ferredoxin oxidoreductases α subunit + β subunit + γ subunit | |
| TLR076 | 2021 | 2 | >91 | Hypothetical protein | |
| TLR271 | 2020 | 2 | >92 | ABC transporters | |
| TLR264 | 1986 | 5 | 1 | >98 | Transposase |
| TLR294 | 1851 | 2 | >98 | ABC transporters + permease component | |
| TLR004 | 1819 | 14 | >98 | Transposase | |
| TLR005 | 1800 | 7 | >98 | Transposase | |
| TLR158 | 1774 | 1 | 2 | >89 | TPR-repeat-contaning proteins |
| TLR048 | 1711 | 2 | >99 | Transposase | |
| TLR223 | 1629 | 2 | >97 | Transposase | |
| TLR008 | 1596 | 21 | >92 | Hypothetical protein | |
| TLR014 | 1592 | 14 | 3 | >87 | Hypothetical protein |
| TLR073 | 1571 | 6 | >93 | Transposase | |
| TLR488 | 1549 | 2 | >98 | ABC transporters | |
| TLR533 | 1506 | 2 | >99 | Pseudotransposase | |
| TLR354 | 1400 | 2 | >91 | Arylsulfatase regulator | |
| TLR152 | 1347 | 2 | 100 | Transposase | |
| TLR478 | 1199 | 2 | >98 | GTPases | |
| TLR107 | 1141 | 2 | >99 | Methyl-accepting chemotaxis protein | |
| TLR070 | 1037 | 3 | 1 | >88 | Hypothetical protein |
| TLR177 | 978 | 2 | 1 | >97 | Hypothetical protein + permeases |
| TLR500 | 885 | 2 | >94 | Hypothetical protein | |
| TLR403 | 848 | 2 | >98 | Pyruvate carboxylase | |
| TLR211 | 663 | 2 | >94 | CheY-like receiver domains | |
| TLR115 | 623 | 8 | 9 | >87 | Predicted site-specific integrase-resolvase |
| TLR250 | 527 | 2 | 100 | Hypothetical protein | |
| TLR429 | 502 | 2 | >95 | Methylmalonyl-CoA mutase | |
| TLR384 | 496 | 3 | >90 | Hypothetical protein | |
| TLR509 | 479 | 2 | >93 | Hypothetical protein | |
| TLR098 | 428 | 2 | 1 | >98 | Hypothetical protein |
| TLR434 | 403 | 2 | >97 | Lactoylglutathione lyase | |
| TLR311 | 369 | 2 | 2 | >95 | Partial transposase |
| TLR537 | 361 | 2 | >98 | ABC transporters | |
| TLR349 | 352 | 2 | 1 | >95 | Hypothetical protein |
-
A copy is complete if the length of the repeat is ε ≥90% of the consensus, otherwise, the copy is partial.
-
↵Two partial copies with 96% identity.
-
↵A 1300 bp deletion in the partial copy.
-
↵One partial copy with 89% identity.
-
↵One partial copy with 94% identity.
-
↵Two partial copies with identities of 92% and 94%, respectively.
