Table 1.

Structure of validated novel transcripts.


Clone name

cDNA end sequence length

Chromosome coordinate

cDNA end orientation

Hit type

Gene

Primer sequence

Tm (°C)
MCF7_RNA_L_18_D17 310 chr2:55448021 Plus E MTIF2 aggaacctgtgcatctttgg
aaagcagcatgtcctggagt 58
553 chr2:43913586 Plus IE PLEKHH2 acccaccatgaagggattg 62
ctttgcaaatctgcctgaca
MCF7_RNA_L_13_D07 526 chr6:100,979,123 Minus E,- HELIC1 gcagctcctaagggtgagtg
chr6:101,033,719 Minus gggattggggtagaggtttt 62
556 chr6:101,002,220 Plus U HELIC1 ttcaatgctgcgattatcctc 62
tccaattcaatcagggacttc
MCF7_RNA_L_18_F09 630 chr7:128,003,608 Minus U CALU ccaggtaatggcaggttcag
chr7:128,003,709 Plus gctggacctatagcaactgaatg 62
547 chr7:128,005,309 Minus U CALU gaagaagaggaaccggatgg 62
aagtcttgagcatttcaacagatg
MCF7_RNA_L_23L23 403 chr16:85,490,770 Plus U KIAA0182 tattcggcaccacactacc
agcaaattgtgcaatggaat 62
405 chr19:16,074,534 Plus IE AK023385 ggtttgtgctgaccatctcc 62






tggatcccaggcattttcta

[i] Key to “Hit type” column: “I”—hit in the intron of a gene, “E”—hit in the exons of a gene; “U”—UTR of a gene, “-”—a hit in intergenic DNA. Since all of these clones were validated using nested primer approach, four primer sequences are reported for each (inner primer set data are given in italics). All PCR products were validated by sequencing.