Structure of validated novel transcripts.
Clone name | cDNA end sequence length | Chromosome coordinate | cDNA end orientation | Hit type | Gene | Primer sequence | Tm (°C) |
|---|---|---|---|---|---|---|---|
| MCF7_RNA_L_18_D17 | 310 | chr2:55448021 | Plus | E | MTIF2 | aggaacctgtgcatctttgg | |
| aaagcagcatgtcctggagt | 58 | ||||||
| 553 | chr2:43913586 | Plus | IE | PLEKHH2 | acccaccatgaagggattg | 62 | |
| ctttgcaaatctgcctgaca | |||||||
| MCF7_RNA_L_13_D07 | 526 | chr6:100,979,123 | Minus | E,- | HELIC1 | gcagctcctaagggtgagtg | |
| chr6:101,033,719 | Minus | gggattggggtagaggtttt | 62 | ||||
| 556 | chr6:101,002,220 | Plus | U | HELIC1 | ttcaatgctgcgattatcctc | 62 | |
| tccaattcaatcagggacttc | |||||||
| MCF7_RNA_L_18_F09 | 630 | chr7:128,003,608 | Minus | U | CALU | ccaggtaatggcaggttcag | |
| chr7:128,003,709 | Plus | gctggacctatagcaactgaatg | 62 | ||||
| 547 | chr7:128,005,309 | Minus | U | CALU | gaagaagaggaaccggatgg | 62 | |
| aagtcttgagcatttcaacagatg | |||||||
| MCF7_RNA_L_23L23 | 403 | chr16:85,490,770 | Plus | U | KIAA0182 | tattcggcaccacactacc | |
| agcaaattgtgcaatggaat | 62 | ||||||
| 405 | chr19:16,074,534 | Plus | IE | AK023385 | ggtttgtgctgaccatctcc | 62 | |
| tggatcccaggcattttcta |
[i] Key to “Hit type” column: “I”—hit in the intron of a gene, “E”—hit in the exons of a gene; “U”—UTR of a gene, “-”—a hit in intergenic DNA. Since all of these clones were validated using nested primer approach, four primer sequences are reported for each (inner primer set data are given in italics). All PCR products were validated by sequencing.