Table 1.

List of Experimentally Detected or Cloned miRNAs at the Mouse Distal 12 Domain


miRNAa

Sequence (5′ to 3′)b

Maternally expressed miRNAs

References
miR-342 UCUCACACAGAAAUCGCACCCGUC n.d. Kim et al. 2004; this study
miR-345 UGCUGACCCCUAGUCCAGUGC — Kim et al. 2004; this study
miR-127 UCGGAUCCGUCUGAGCUUGGCU + Lagos-Quintana et al. 2002; Seitz et al. 2003
miR-136 ACUCCAUUUGUUUUGAUGAUGGA + Lagos-Quintana et al. 2002; Seitz et al. 2003
miR-134 UGUGACUGGUUGACCAGAGGG + Lagos-Quintana et al. 2002; this study
miR-154/miR-A19-5c UAGGUUAUCCGUGUUGCCUUCG + Lagos-Quintana et al. 2002; this study
miR-323/miR-A1-3′ GCACAUUACACGGUCGACCUCU n.d. Kim et al. 2004; this study
miR-329/miR-A2-3′ AACACACCCAGCUAACCUUUUU n.d. Kim et al. 2004; this study
miR-300/miR-A9-3′ UAUGCAAGGGCAAGCUCUCUUC n.d. Houbaviy et al. 2003; this study
miR-409/miR-A22-3′ GAAUGUUGCUCGGUGAACCCCUU n.d. this study
miR-410/miR-A24-3′ AAUAUAACACAGAUGGCCUGUU + this study
miR-376b/miR-B4 AUCAUAGAGGAACAUCCACUUU + this study
miR-376/miR-B6 AUCGUAGAGGAAAAUCCACGUU + this study
miR-411/miR-C2 AACACGGUCCACUAACCCUCAGU + this study
miR-380-3p/miR-C3 UAUGUAGUAUGGUCCACAUCUU + this study
miR-299/miR-D UGGUUUACCGUCCCACAUACAU n.d. Houbaviy et al. 2003; this study
miR-412/miR-K ACUUCACCUGGUCCACUAGCCGU n.d. this study
miR-337/miR-M UCAGCUCCUAUAUGAUGCCUUUC + Kim et al. 2004; this study
miR-370/miR-Nd GCCUGCUGGGGUGGAACCUGGUU + this study
miR-341e
UCGAUCGGUCGGUCGGUCAGU
n.d.
Kim et al. 2004

n.d. indicates not determined.

a Novel miRNA sequences have been submitted to the miRNA registry (http://www.sanger.ac.uk/cgi-bin/Rfam/mirna/browse.pl.) and they have been given new names in accordance to the miRNA registry numbering (e.g. miR-A22-3′ is also called miR-409 in the miRNA registry).

b The exact length of the miRNAs which have been detected solely by primer extension is not known. Thus, the two last nucleotides at the 3′-termini are in italics as they are only predicted based on a 23 nt theoretical long RNA species. Primer extension assay generates two cDNA products with a size differing by one nucleotide. Based on the miR-134 and miR-154 sequences obtained independently by cloning strategies (Lagos-Quintana et al. 2002), we have considered the shorter cDNA product as the correct 5′ termini while the longer one might correspond to in vivo processing heterogeneity and/or addition of an extra nucleotide in a matrix-independent manner by the AMV reverse transcriptase (Promega technical service, pers. comm.).

c miR-154/A19 are processed from the 5′ side of A19 (Lagos-Quintana et al. 2002) while miR-323/A1, miR-329/A2, miR-A9, miR-A22 and miR-A24 are processed from the 3′ strand of the A1, A2, A9, A22 and A24 gene copies, respectively suggesting that both strands of A-type can potentially be converted to miRNAs.

d Depending upon RNA samples, we could also detect a ladder-like pattern superimposed to the mature 5′ end of miR-N. Thus, this miRNA might not fulfill the stringent criteria described in (Ambros et al. 2003).

e mir-341 was not found in our in silico search as it is not conserved at the human inprinted 14q32 interval.