Markup | Genome Research

Table 2.

Selected List of Repetitive Elements in the Thermoanaerobacter tengcongensis Genome

Repeat ID	Length (bp)	Number of copies		Identity (%)	Short noncoding repeats
TSR001	30	305 (67/238)		100	`TSR001a(GTTTTTAGCCTACCTAAAAGGGATTGAAAC)`
					`TSR001b(GTTTTTAGCCTACCTAAGAGGGATTGAAAC)`
TSR027	−250	18		<87
		Copies
		Complete	Partial		Long coding repeats
TLR028[ii]	3565	4	5	>99	Transposase + hypothetical protein + transposase
TLR393[iii]	3045	2	1	>98	ABC transporters + hypothetical protein
TLR315	2603	2		>94	ABC transporters + permease component + conserved hypothetical protein
TLR408	2490	2		>98	Ferredoxin oxidoreductases α subunit + β subunit + γ subunit
TLR076	2021	2		>91	Hypothetical protein
TLR271	2020	2		>92	ABC transporters
TLR264	1986	5	1	>98	Transposase
TLR294	1851	2		>98	ABC transporters + permease component
TLR004	1819	14		>98	Transposase
TLR005	1800	7		>98	Transposase
TLR158	1774	1	2	>89	TPR-repeat-contaning proteins
TLR048	1711	2		>99	Transposase
TLR223	1629	2		>97	Transposase
TLR008	1596	21		>92	Hypothetical protein
TLR014	1592	14	3	>87	Hypothetical protein
TLR073	1571	6		>93	Transposase
TLR488	1549	2		>98	ABC transporters
TLR533	1506	2		>99	Pseudotransposase
TLR354	1400	2		>91	Arylsulfatase regulator
TLR152	1347	2		100	Transposase
TLR478	1199	2		>98	GTPases
TLR107	1141	2		>99	Methyl-accepting chemotaxis protein
TLR070	1037	3	1	>88	Hypothetical protein
TLR177[iv]	978	2	1	>97	Hypothetical protein + permeases
TLR500	885	2		>94	Hypothetical protein
TLR403	848	2		>98	Pyruvate carboxylase
TLR211	663	2		>94	CheY-like receiver domains
TLR115	623	8	9	>87	Predicted site-specific integrase-resolvase
TLR250	527	2		100	Hypothetical protein
TLR429	502	2		>95	Methylmalonyl-CoA mutase
TLR384	496	3		>90	Hypothetical protein
TLR509	479	2		>93	Hypothetical protein
TLR098[v]	428	2	1	>98	Hypothetical protein
TLR434	403	2		>97	Lactoylglutathione lyase
TLR311[vi]	369	2	2	>95	Partial transposase
TLR537	361	2		>98	ABC transporters
TLR349	352	2	1	>95	Hypothetical protein

[i] A copy is complete if the length of the repeat is ε ≥90% of the consensus, otherwise, the copy is partial.

[ii] Two partial copies with 96% identity.

[iii] A 1300 bp deletion in the partial copy.

[iv] One partial copy with 89% identity.

[v] One partial copy with 94% identity.

[vi] Two partial copies with identities of 92% and 94%, respectively.