Cooperation between Reb1p and NNS factors for Pol II transcription termination of SNR161. (A) Genome browser view of the SNR161-PDX3 region. The y-axis indicates reads per million (rpm) of PATs for the indicated FRB-tagged strains after 1 h of rapamycin treatment. (B) Northern blot analysis of sense and anti-sense transcripts at the SNR161 locus. The Reb1p binding site in the SNR161 terminator was mutated (mut) or replaced with a cleavage site for the yeast RNase III homolog Rnt1p (RCS). Probes 1 and 2 detect the negative strand transcripts (sense to snR161), while probes 3 and 4 detect positive strand transcripts (anti-sense to snR161). 18S rRNA is shown as a loading control. (C) Northern blot analysis on rrp6Δ with a Reb1p binding site mutation (TTACCCG → TTACAAG) or replacement with indicated proteins and their respective binding sites: Abf1p, TTTGATCGCTTTGTACGTGC; Cbf1p, TTTTTATCATGTGACTTATG; Mcm1p, TTACCTAATTAGGTAA; Tbf1p, TTCTTAGGGTTAAATA; Mig1p, AAGCTGAAAATCTGGGGAAG; and Rap1p, AGCAACACCCAGACATTACA. The Tbf1p binding site inadvertently introduced an additional TCTT motif for Nab3p (underlined). Probe 2 detects 3′-extended snR161 precursors, while probe 5 detects mature PDX3 mRNA and the SNR161-PDX3 readthrough product. (D) The indicated anchor away strains were treated with 1 μg/mL rapamycin for 1 h and Northern blots probed for the region downstream from SNR161 (probe 2). (E) Effect of Reb1p overexpression on PDX3 and SNR161-PDX3 expression upon Nab3 nuclear depletion. WT and NAB3-FRB strains were transformed with the BG1805 plasmid harboring a galactose-inducible REB1. Strains were grown in raffinose to mid-log phase and then were either treated with 1 μg/mL rapamycin for 1 h (left four lanes) or shifted to galactose for 2 h prior to the addition of rapamycin (right four lanes). Probe 2 detects the SNR161-PDX3 readthrough transcript with partial overlap with PDX3 5′ UTR. Probe 5 detects mature PDX3 mRNA and the readthrough product.
