miRNA candidates confirmed at the molecular level
Candidate | Family and locusa | Intergenic regionb | Predicted miRNA sequencec | Predicted target transcriptsd | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| cmr3 | miR395JR | a | At1g26990 | 5.3 kb | CUGAAGUGUUUGGGGGAACUC | At5g43780JR | APS4 | |||
| b | At1g26990 | 4.0 kb | CUGAAGUGUUUGGGGGGACUC | At3g49430 | SF2 (SR1) | |||||
| c | At1g26990 | 1.4 kb | CUGAAGUGUUUGGGGGGACUC | At2g28780 | exp | |||||
| d | At1g69800 | 4.4 kb | CUGAAGUGUUUGGGGGAACUC | At5g10180 | Sulfate Transporter | |||||
| e | At1g69800 | 1.6 kb | CUGAAGUGUUUGGGGGAACUC | |||||||
| f | AT1g69800 | 0.5 kb | CUGAAGUGUUUGGGGGGACUCu | |||||||
| cmr6 | miR399JR,S | a | At1g29270 | UGCCAAAGGAGAUUUGCCCug | At2g33770S | UBC (607 627) | ||||
| d | At2g34210 | 2.9 kb | UGCCAAAGGAGAUUUGCCC | (740 760) | ||||||
| e | At2g34210 | 2.3 kb | UGCCAAAGGAGAUUUGCCU | (830 849) | ||||||
| f | At2g34210 | 0.9 kb | UGCCAAAGGAGAUUUGCCC | (887 906) | ||||||
| b | At1g63010 | UGCCAAAGGAGAGUUGCCC | (943 963) | |||||||
| c | At5g62165 | UGCCAAAGGAGAGUUGCCC | At4g09730* | DEAD/DEAHboxhelicase | ||||||
| cmr7 | At5g35340 | uaaUAACCGAACCCGAACCGAUuug | At2g31700 | hyp (186 210) | ||||||
| At5g35360 | uaaUACCCGAACCCGAACCGAUacc | (207 231) | ||||||||
| At1g75980 | exp | |||||||||
| At1g28540 | exp | |||||||||
| At3g16760 | TPR | |||||||||
| At5g05250 | exp | |||||||||
| At1g13100 | Cytochrome P450 | |||||||||
| cmr214 | miR393JR,S | a | At2g39890 | aagAUCCAAAGGGAUCGCAUUG | At3g62980JR,S | TIR1 | ||||
| b | At3g55740 | AUCCAAAGGGAUCGCAUUG | At3g26810JR,S | |||||||
| At1g12820JR,S | ||||||||||
| At4g03190JR,S | ||||||||||
| At4g19780 | copia | |||||||||
| At4g17450 | copia | |||||||||
| cand1 | miR390S,C | b | At5g58470 | agCUCAGGAGGGAUAGCGCCau | At1g30040* | GA2OX2 | ||||
| a | At2g38330 | CUCAGGAGGGAUAGCGCC | At5g53470 | acyl-CoA BP | ||||||
| At4g13430 | Aconitase | |||||||||
| At5g14210 | LRR-kinase | |||||||||
| At4g08850* | LRR-kin (964 985) | |||||||||
| (1612 1633) | ||||||||||
| At4g03205 | copro-ox | |||||||||
| At1g03475 | copro-ox | |||||||||
| At5g07280 | LRR-kinase | |||||||||
| At1g60720 | hyp | |||||||||
| At1g56130 | LRR-kinase | |||||||||
| At1g61520 | CAB | |||||||||
| cand2 | miR394JR | a | At1g20380 | UUUGGCAUUCUGUCCACCUCCu | At1g27340JR | F-box | ||||
| b | At1g76140 | UUUGGCAUUCUGUCCACCUCC | At1g10200 | LIM | ||||||
| At4g24850/60* | AAA-ATPase/MSP1 | |||||||||
| At5g20580 | exp | |||||||||
| anti-cand3 | miR398JR,S | a | At2g03450 | uguGUUCUCAGGUCACCCCUU | At3g15640JR,S | Cyt C oxidase VB | ||||
| b | At5g14550 | ugugUUCUCAGGUCACCCCUGCUG | At3g06370* | NHX3 putative | ||||||
| c | At5g14570 | uguguucucaggucaccccug | At1g08830*JR | CSD1 | ||||||
a Rfam IDs for miRNAs that overlap the predicted candidates. For cand3, the antisense strand that corresponds to miR398 was found in the findMiRNA records. (JR) Jones-Rhoades and Bartel (2004); (S) Sunkar and Zhu (2004); (C) Carrington lab.—Arabidopsis thaliana Small RNA project—http://gac.bcc.orst.edu/smallRNA/
b Intergenic regions containing precursor loci as defined by TAIR (intergenic regions are North of loci corresponding to AGI locus indentifiers). Where more than one locus occurs in an intergenic region, the position of the precursor relative to the AGI locus is indicated in kilobase pairs
c Predicted miRNA sequence identified by findMiRNA is in uppercase. Underlined sequence was used with predicted target mRNAs to estimate miRNA-target stabilities (see Supplemental material). In the case of miR398 (anti-cand3), the predicted miRNA sequence was extended to fit a previously cloned miRNA, miR398b (Jones-Rhoades and Bartel 2004; Carrington J. lab. Arabidopsis thaliana Small RNA project, http://gac.bcc.orst.edu/smallRNA/)
d Potential target transcripts were identified with a demand for an alignment with no single-strand bulges. Numbers refer to AGI locus identifiers and are ordered from top to bottom with decreasing thermal stability with predicted miRNA (also see Supplementary material). Those in bold type or underlined have respectively conserved or potentially conserved target sites in related transcripts in other plant species. When more than one target site occurs within the transcript, the corresponding nucleotides are indicated in the parentheses. Transcript IDs with asterisks correspond to targets that were manually identified and were not identified by findMiRNA at the 500 result limit. At4g24850/60 represent a pair of overlapping loci. (JR) Jones-Rhoades and Bartel (2004); (S) Sunkar and Zhu (2004) have suggested targets and these are underlined where cleavage products were detected by 5′ RACE. (exp) Expressed; (hyp) hypothetical protein; (SP2) pre-mRNA splicing factor 2, (TPR) tetratricopeptide repeat containing protein; (LRR-kin) leucine rich repeat kinase; (copro-ox) coproporthyrin III oxidase; (CAB) chlorophyll A-B binding protein; (MSP1) intramitochondrial sorting protein 1; (NHX3) putative sodium proton exchanger; (CSD1) copper/zinc superoxide dismutase