Combinatorial binding of transcription factors in the pluripotency control regions of the genome									
Table S5	MORE and PORE Oligonucleotide Scores								
NOTE: This first sheet refers to exact matches to the PORE element. Multiple sheets refer to numbers of mismatches tolerated from element. The following may be exported as a UCSC Bed format file.									

chr	left	right	sequence+matches model	OCT1 score	OCT4 score	OCT1 % enrich	OCT4 % enrich	oligo_loc	oligo seq
"track name=""OSNPORE_upto0mismatches"" description=""pluCR PORE finding allowing up to 0 mismatches with the models PORE:ATTTGNNAKGCAAAT, ATTTGCMTNNCAAAT;"""									
chr12	100370493	100370508	ATTTGCATAACAAAT:PORE	0.395	1.01	0.983701493	0.986145575	chr12:100370479-100370509	GACTGTGTGTTAACATTTGCATAACAAATT
chr22	38662540	38662555	ATTTGCATAACAAAT:PORE	0.747	1.448	0.998	0.999350112	chr22:38662529-38662559	AAAAGGTAGTTATTTGCATAACAAATTTTC
chr12	100370493	100370508	ATTTGCATAACAAAT:PORE	0.218	1.227	0.922925373	0.996012052	chr12:100370489-100370519	TAACATTTGCATAACAAATTGGCTCAAAAA
chr22	38662540	38662555	ATTTGCATAACAAAT:PORE	0.844	1.568	0.998746269	0.999763677	chr22:38662539-38662569	TATTTGCATAACAAATTTTCCTTTCATTTT