Systematic Discovery of New Genes in the Saccharomyces cerevisiae Genome
Abstract
We used genome-wide comparative analysis of predicted protein sequences to identify many novel small genes, named smORFs forsmall open readingframes, within the budding yeast genome. Further analysis of 117 of these new genes showed that 84 are transcribed. We extended our analysis of one smORF conserved from yeast to human. This investigation provides an updated and comprehensive annotation of the yeast genome, validates additional concepts in the study of genomes in silico, and increases the expected numbers of coding sequences in a genome with the corresponding impact on future functional genomics and proteomics studies.
Current consensus suggests the number of yeast genes to be very close to 6000 (Goffeau et al. 1996; Mewes et al. 1997; Winzeler and Davis 1997). The number of protein-coding genes with open reading frames (ORFs) longer than 100 codons is predicted to be between 5300 and 5400 (Mackiewicz et al. 2002). Two recent studies suggest that the determination of gene numbers by stringent gene identification methods may underestimate the number of genes in human and other organisms (Gopal et al. 2001; Reboul et al. 2001). The initial annotation of the budding yeast genome did not include many short open reading frames (ORFs; Andrade et al. 1997; Olivas et al. 1997). Recent experimental studies designed to catalog all genome transcripts using SAGE technology (Velculescu et al. 1997; Basrai et al. 1999) and the analysis of a collection of transposon insertions (Ross-Macdonald et al. 1999) have discovered new ORFs that were not previously identified in silico. This pool of genes includes some that code for putative proteins that are shorter than 100 amino acids (Velculescu et al. 1997; Basrai et al. 1999; Ross-Macdonald et al. 1999). Two recent studies described the use of comparative sequence analysis between the genome of Saccharomyces cerevisiaeand those of other hemiascomycetous yeasts (Blandin et al. 2000) or other Saccharomyces genomes (Cliften et al. 2001) to discover small nonannotated protein-coding and nonprotein-coding genes in chromosomal regions previously considered intergenic. In addition, transposon insertion was recently used to identify yeast genes that were previously overlooked (Kumar et al. 2002).
Here we describe a systematic in silico method to identify new small genes in S. cerevisiae that is an extension of the searches conducted by Blandin and Cliften (Blandin et al. 2000; Cliften et al. 2001) by using a more comprehensive database of fungal sequences. In addition we provide a comprehensive demonstration that the majority of the genes predicted are actually transcribed. Our findings from comprehensive database searches and experimental studies suggest that the number of coding genes in S. cerevisiae is substantially higher than currently believed.
RESULTS
Identification of New ORFs
While comparing whole fungal genomes, we (Zeng et al. 2001) as well as others (Kupfer et al. 1997; Tzung et al. 2001) made the observation that fungal translated ORFeomes are very diverse. For example, manyS. cerevisiae proteins do not have homologs in Candida albicans (Tzung et al. 2001). However, comparison ofS. cerevisiae predicted translated ORFs with a comprehensive fungal database that includes predicted protein sequences from C. albicans, Schizosacharomyces pombe, Aspergillus nidulans and fumigatus, Cryptococcus neoformans,Fusarium sporotrichioides, Neurospora crassa, andPneumocystis carinii suggests that most budding yeast translated ORFs have homologs in one or more other fungal genomes (Zeng et al. 2001). We used this observation to identify novel protein-coding sequences in the budding yeast genome.
Our approach to identify candidate ORFs for new genes in the S. cerevisiae genome is outlined in Figure1. Briefly, we started with the S. cerevisiae genomic sequence (12.07 mb total) and removed the nucleotide sequences of the previously identified 6,224 coding ORFs (Saccharomyces Genome Database, December 5 1997,http://www.genome-www.stanford.edu/Saccharomyces). We then used the remaining sequences (3.45 mb) to identify all stop-to-stop ORFs that encode proteins with an arbitrary size of 18 amino acids or longer, based on the observation in E. coli that the majority of genes code for proteins with 18 or more amino acids (E. coli Genome Center, University of Wisconsin, Madison.http://www.genetics.wisc.edu/).
Overall strategy for smORF identification. Computational method used to identify new ORFs not identified by conventional methods.
This approach resulted in approximately 140,000 predicted ORF products, most of them shorter than 100 residues. These ORF products were next searched against a comprehensive fungal protein sequence database to identify those with potential homologs. This fungal database consists of all NCBI entries listed under “fungi” (August 20, 2000, excluding any S. cerevisiae sequences), plus the genomic sequences from C. albicans (Stanford University) and A. fumigatus (PathoGenome; http://www.LabOnWeb.com), EST sequences from A. nidulans, C. neoformans, F. sporotrichioides, and N. crassa (University of Oklahoma Health Sciences Center), and P. carinii EST sequences (University of Georgia). Using a cutoff score ofP ≤ 10−4 (this score was chosen because it is reasonably stringent for short translated ORFs), we found 1057 S. cerevisiae predicted ORF products with potential homologs in the fungal database. ORFs were considered similar when the region of sequence similarity between the small openreading frame (smORF) and the predicted protein(s) from our database extends over the entire coding region. We then removed the ORFs which were annotated after 1997 and while this work was in progress, those that overlap with rRNA, tRNA, and Ty elements, and selected the smORFs with a start-to-stop ORF and with an upstream in-frame stop. This approach resulted in 558 smORFs that code for predicted proteins with potential fungal homologs and are located in chromosomal sections previously identified as intergenic. The 558 smORFs range in length from 18–190 codons with a mean of 64.99 codons, a median of 64 codons, and a mode of 62 codons. A unique aspect of our search is that a comprehensive database of fungal genomic and cDNA sequences was used in the sequence similarity searches as opposed to the databases containing hemiascomycetous and Saccharomycesspecies used in the studies of Blandin, Cliften, and coworkers (Blandin et al. 2000; Cliften et al. 2001).
ORF Validation
We chose a subset of 117 smORFs for further characterization and validation (Table 1). As a first step we determined whether smORFs were expressed in yeast cells. Primers were designed to amplify smORFs 2, 8, and 31 as well as theACT1 gene (actin) as control (see Methods), and used for polymerase chain reaction (PCR) amplification with S. cerevisiae genomic DNA as a template to test the PCR amplification conditions. Products of the predicted size were obtained for all three smORFs as well as the actin control (Fig.2A, lanes 2,6,10,14). No PCR products were obtained in reactions without the template (Fig. 2A, lanes 1,5,9,13), or using as a template RNA isolated from S. cerevisiae grown on rich (YPD) or complete synthetic minimal (CSM) media (Fig. 2A, lanes 3,4,7,8,11, 12,15,16). This indicates that these RNA samples were not contaminated with genomic DNA. We then tested for the presence of RNA transcripts originating from these smORFs as well as from the actin control, using RT-PCR. Products of the expected sizes were obtained for actin, as well as all three smORFs (Fig. 2B, lanes 2,3,5,6,8,9,11,12). This indicates that actin and the three smORFs are indeed expressed in yeast cells grown in rich and in minimal media. No RT-PCR product was obtained in reactions without a template (Fig. 2B, lanes 1,4,7,10). The identity of the RT-PCR products was confirmed by cloning them, followed by restriction mapping and dideoxy sequencing (data not shown).
List of S. cerevisiae smORFs for Which a Transcript was Detected
Experimental validation of the S. cerevisiae smORFs. (A) Primers specific for the yeast ACT1 gene as well as the three smORFs were used for PCR amplification using no template (lanes 1,5,9,13), 50 ng genomic DNA (lanes 2,6,10,14), 500 ng total RNA from cells grown in rich media (lanes3,7,11,15), and 500 ng total RNA from cells grown in minimal media (lanes4,8,12,16) .(B) Primers specific for the yeast ACT1 gene as well as the three smORFs were used for RT-PCR amplification using no template (lanes1,4,7,10), 500 ng total RNA from cells grown in rich media (lanes2,5,8,11), and 500 ng total RNA from cells grown in minimal media (lanes3,6,9,12). PCR and RT-PCR products were fractionated on a 1% agarose gel with DNA size markers and visualized after ethidium bromide staining. Sizes of DNA fragments in bp are indicated. (C) Two-step orientation-specific RT-PCR. Primers whose sequence is complementary to the predicted mRNAs of smORF2, 8, and 31 were used for first-strand cDNA synthesis. After heat inactivation of the reverse transcriptase, PCR amplification was carried out with both smORF-specific primers (lanes5,6,11,12,17,18). As control, the experiment was repeated using primers with the same sequence as the mRNA for first-strand cDNA synthesis (lanes3,4,9,10,15,16). (D) Examples of RT-PCR results with various smORFs indicated on top. RT-PCR detection of transcripts from the annotated smORFs YLL018C-A and YHR132W-A are shown. smORFs for which RT-PCR reactions resulted in no products are indicated (*) as are those for which the product is not of the expected size (∧). These smORFs were not included in Table 1. Sizes of DNA fragments in bp are indicated. (E) Transcript size determination by Northern analysis of the ACT1 (lane 3), smORF2 (lane 5), and smORF31 (lane7). Unlabeled RNA markers stained with methylene blue (lane1) and labeled RNA markers (lanes2,4,6) were fractionated together with yeast poly (A)+ RNA. Sizes are shown in nucleotides.
We then wanted to make sure that the smORF transcripts we identified were transcribed from the predicted DNA strand. To do this, we performed a variation of the RT-PCR experiment, first adding a primer complementary to the predicted mRNA and the reverse transcriptase. After first-strand cDNA synthesis, the reverse transcriptase was inactivated with heat and then Taq polymerase and both smORF-specific primers were added (Fig. 2C). Under these conditions we observed PCR products only when first-strand synthesis was conducted with primers complementary to the predicted mRNA (Fig. 2C, lanes 5,6,11,12,17,18). No PCR product was observed when first-strand synthesis was done with primers that have the same sequence as the mRNA (lanes 3,4,9,10,15,16). These results indicate that the transcripts observed for smORFs 2, 8, and 31 are made from the predicted strand.
This same study was extended to 114 additional smORFs. RT-PCR products of the expected size were obtained for 81 of these smORFs (e.g., Fig.2D). Therefore, 84 of the 117 smORFs are transcribed from the predicted DNA strand (Table 1). The codon adaptation index (CAI,http://www.molbio.oc.ac.uk) was calculated for the 84 smORFs (Table 1), and they range from 0.045–0.282. Similar values were obtained for the 6224 annotated yeast genes. Nine of the smORFs in this list were recently annotated by Blandin, Cliften, and coworkers (Blandin et al. 2000; Cliften et al. 2001). We originally found SR12 downstream of the AST1gene, which was recently reannotated and extended, and now includes SR12 (Saccharomyces Genome Database, 2001;http://www.genome-www.stanford.edu/Saccharomyces). In addition we also identified smORF 68 and had an RT-PCR product for it. This smORF maps to YCL057C-A, which was recently removed from theSaccharomyces Genome Database (Saccharomyces Genome Database, 2001; http://www.genome-www.stanford.edu/Saccharomyces). The majority of the smORFs were found only once in the budding yeast genome, except for SR15, which is present four times in chromosome 12, downstream of ASP3, in a 3.6-kb repeat region of this chromosome (Johnston et al. 1997). Even though we detected an RT-PCR product for this smORF, we do not know which copy was transcribed. To address the possibility that the observed smORF transcripts were products of read-through transcription from genes located upstream of the smORFs, the RT-PCR experiment was conducted using a primer complementary to the mRNA for first-strand synthesis (Fig. 2C) and with a second primer located 400 base pairs (bp) upstream of the smORF. With these conditions, no RT-PCR products were observed for 25 smORFs tested, indicating that the smORF transcripts are not the result of read-through transcription from upstream genes (data not shown). To confirm these observations, we measured the size of the transcripts coded for by smORFs 2, 31, and the ACT1 gene using Northern analysis (Fig. 2E). The size of the ACT1 mRNA was 1300 nucleotides (nt; lane 3). The mRNAs for both smORF2 and 31 have a measured size of 460 nt (Fig. 2E, lanes 5,7), in agreement with a size predicted for a 250-nt ORF, a 20–30-nt 5′ untranslated region (Hughes et al. 2000), a 100-nt 3′ untranslated region (Graber et al. 2002), and a poly (A) tail of 70–90-nt (Hector et al. 2002). Northern analysis of smORF2 transcripts shows a band of 780 nt that could correspond to alternative processing variants. It is unlikely that this band represents read-through from the gene located upstream of smORF2 (SNR56), because it is located 1700 bp upstream. This results indicate that the observed transcripts originate in the promoter of the smORFs.
Characterization of smORF2
We now present a comprehensive analysis of smORF2, as homologs of this protein (smORF2p) are found in many organisms from yeast to humans (Fig. 3), and its deletion fromS. cerevisiae exhibits a tractable phenotype. The human,Caenorhabditis elegans, Drosophila melanogaster, and S. pombe smORF2p homologs are about the same size as the S. cerevisiae counterpart. smORF2 was recently annotated by Blandin and coworkers (2000) with the systematic name YBL071W-A.
Multiple sequence alignments for smORF2p. smORF2p has highly conserved homologs in other fungi and in mammalian species. Abbreviations: Dm,Drosophila melanogaster; Hs, Homo sapiens; Ce,Caenorhabditis elegans; Sc, Saccharomyces cerevisiae; Ca, Candida albicans; Af, Aspergillus fumigatus; An,Aspergillus nidulans; Sp, Schizosaccharomyces pombe; Bt, Bos taurus; Mm, Mus musculus. Residues that are identical or similar in all protein homologs are shaded in black, and those identical or similar in two or more, but not all, proteins in the alignment are shaded in gray. Homology shading was done with GeneDoc (Nicholas et al. 1997).
We extended our study of smORF2p to determine whether we could detect a protein product of the appropriate size. A triple HA tag was fused to the C-terminus of smORF2 by PCR, and the wild-type smORF2 gene was replaced with the tagged version by allele replacement into the chromosome (Ederniz et al. 1997). PCR amplification of the smORF2 (HA)3 gene from genomic DNA, followed by cloning and sequencing, confirmed the identity of the tagged smORF2. Soluble extracts were then prepared and fractionated in 18% polyacrylamide gels containing sodium dodecyl sulfate. The proteins were transferred to a poly (vinylidene) fluoride (PVDF) membrane, and the blot was probed with anti-HA antibodies. The results show a protein band corresponding to a 9-kD protein (Fig.4, lanes 3,4) in extracts prepared from cells with a tagged smORF2 gene and not in wild-type cells. This result shows that smORF2 is not only transcribed, but also encodes a detectable protein product of the expected size.
smORF2 is expressed in yeast. A triple HA tag was fused to the C-terminal end of smORF2 using PCR, and the wild-type smORF2 gene was replaced by the tagged smORF2 gene by allele replacement into the chromosome. Soluble extracts were prepared and analyzed in a Western blot probed with monoclonal antibodies that recognize the HA epitope. Extracts from wild-type cells (lane 2) and extracts from two separate isolates carrying the HA-tagged smORF2 (lanes3,4).
We then extended our study of smORF2 to determine whether this gene is essential or whether its deletion results in an observable phenotype. The complete smORF2 gene was deleted in a diploid yeast strain, using homologous recombination. Sporulation and tetrad analysis showed that haploid strains with a smorf2Δ were able to grow at 30°C (slow growth), but not at 37°C (Fig.5). To extend the notion of smORF to humans, we next tested whether the human smORF2 is a functional homolog of the yeast smORF2. The human smORF2 gene, obtained from an EST clone, and the yeast smORF2 were cloned into the pYES vector for expression in yeast under the GAL1 promoter. Clones were verified by sequencing and transformed into the smorf2Δ strain. The resultant transformants were tested for the ability to complement the temperature-sensitive phenotype of thesmorf2Δ strain and their ability to form colonies at the restrictive temperature. The results show that the cloned human smORF2 as well as the yeast smORF2 can complement the temperature-sensitive phenotype of the smorf2Δ strain (Fig. 5). These results indicate that the human smORF2 is a functional ortholog of the yeast smORF2. Interestingly, the human smORF2 maps to two loci in the human genome, one in chromosome 3 where the gene contains two introns and codes for a predicted mRNA identical to the EST, and to a locus in chromosome 20 without introns but with nine predicted amino acid substitutions. These data indicate that small ORFs are present and expressed in humans, and they underscore the importance of looking for small genes in the genomes of higher eukaryotes.
Human smORF2 complementation of the temperature-sensitive phenotype of the smorf2Δ strain. A yeast strain with a deleted smORF2 (smorf2Δ) was transformed with plasmids carrying the wild-type yeast smORF2, human smORF2 under the control of the GAL1 promoter, or empty vector. Transformants were obtained at 30°C, and individual colonies were streaked and then incubated at 30°C and 37°C.
DISCUSSION
We have validated a method for gene identification in sequenced genomes and used it to identify new genes in S. cerevisiae. With this method one should be able to find new coding ORFs in S. cerevisiae by simply searching potential budding yeast ORF products against sequences from other fungal and nonfungal species. Even though we did not verify the expression of every predicted smORF, we found strong evidence for close to 100 new genes in the S. cerevisiae genome. The limited study reported here can be expanded to include smORFs that partially overlap with annotated ORFs and smORFs that are completely located within previously annotated ORFs as described recently by Kumar et al. (2002). This systematic genome comparison approach to identify ORFs will accelerate and refine genome annotation and gene identification and will impact future experimental design. The identification of conserved protein products across a wide range of species can provide us with the opportunity to use S. cerevisiae and other fungi to study the function of their counterparts in humans. In addition, our approach can be applied to other sequenced genomes including human in order to identify coding ORFs not readily detected by conventional methods. We anticipate finding additional smORFs which do not yet have a homolog as the amount of available sequence data increases. Conversely, we will miss some smORFs that are species-specific and therefore have no homologs in other species. We refer to these species-specific smORFs as orphan smORFs. This study and others involved in gene discovery will change the landscape of genome annotation and therefore the approach in experimental design.
METHODS
RT-PCR Analysis
Genomic DNA was prepared from strain W303 (Thomas and Rothstein 1989) using the YeaStar Genomic DNA kit (Zymo Research). Primers pairs were chosen to amplify 250–300-bp regions within the coding ORFs of the yeast ACT1 gene (5′-TGTCACCAACTGGGACGATA-3′; 5′-AACCAGCGTAAATTGGAACG-3′), smORF2 (5′-TGACGAAATCGAAATCGAAG-3′; 5′-GATGCCTGCCTCTTCGTAGT-3′), smORF8 (5′-TG CCTAAGAGATTAAGTGGGTT-3′; 5′-CGTCAGTTCAGGGT GTGAAA-3′), smORF31 (5′-TGTCTGCATTATTTAATTTTC GTTC-3′; 5′-AGCTGTTAAATTGACTGATGGC-3′).
RNA was isolated from 5 × 107 yeast cells (strain W303) growing exponentially in YEPD or synthetic complete synthetic minimal media using the RNeasy Mini kit from QIAGEN including a DNase (Roche) digestion step. RT-PCR reactions were done with the OneStep RT-PCR Kit from QIAGEN as recommended by the manufacturer. RT-PCR products were fractionated on a 1% agarose gel and visualized after ethidium bromide staining. For sequencing, the RT-PCR products were isolated from an agarose gel and then cloned into pCR2.1-TOPO (Invitrogen). To test expression of the 117 smORFs, primers were chosen within the coding sequence to amplify fragments of 25 bp or longer.
Strand-Specific RT-PCR Analysis
First-strand ynthesis was conducted using yeast RNA, primers as indicated, and SuperScript II reverse transcriptase (Life Technologies) as recommended by the manufacturer. PCR amplification was conducted using PCR SuperMix (Life Technologies), smORF-specific primers, and 8.5% of the first-strand reaction.
For Northern analysis, 0.8 μg yeast poly (A)+ RNA together with DIG-labeled and unlabeled RNA markers (Invitrogen) were fractionated in 1.5% formaldehyde-agarose gel as recommended (Ambion), transferred to Nylon membrane, and probed with single-stranded antisense probes against ACT1 (Fig. 2E, lanes 2,3), smORF2 (lanes 4,5), and smORF31 (lanes 6,7) labeled with DIG-UTP and detected as recommended (Roche).
Epitope Tagging
The modified smORF2 (HA)3 was constructed by two-way PCR. First, a PCR amplification was made using a primer corresponding to 400 bp upstream of smORF2 (5′-AGAAAGCCCTCAAGCTTTCCCAGCG) and a second primer containing the C-terminus of smORF2 fused to the HA tag (5′-GGAGCCTGATCCAGCGTAGTCTGGGACGTCG TATGGGTAGCCAGCGTAGTCTGGGACGTCGT ATGGGTAGCCAGCGTAATCCGGAACATCATAC GGGTATCCTACGGCAGCAGCGGCAATAGGCTCAGG-3′). A second amplification was carried out with a forward primer containing the tag (5′-GTAGGATACCCGTATGATGTTCCG GATTACGCTGGCTACCCATACGACGTCCCAG ACTACGCTGGCTACCCATACGACGTCCCAGA CTACGCTGGATCAGGCTCCTAAAGATGAGAG GCTAGATCGAG-3′) and a primer located downstream of smORF2 (5′-TGTCGCTTTTTCTCCTCGATGAAGC CAAGCGCCGAACCAATTGATATCATCGGCACG-3′). The tagged smORF2 gene was introduced into the smORF2 locus by allele replacement (Ederniz et al. 1997). Allele replacement was first checked by PCR and then verified by PCR amplification of the tagged gene, cloning into pCR2.1-TOPO (Invitrogen) and sequencing.
S100 extracts were prepared from diploid W303 yeast cells grown in 25 mL of rich medium (YPD) to mid-log phase as described (Brown et al. 1996). Immunoblots were probed with a 1:1000 dilution of the 16B12 monoclonal antibody (Berkeley Antibody) against HA3-tagged proteins.
Gene Disruption
smORF2 was disrupted in the diploid W303. Cells were transformed with a PCR fragment containing the HIS3 marker flanked by 400 bp of smORF2 sequences. The HIS3 sequences replaced amino acids 1 to 82 of smORF2. Histidine prototrophs were selected, and PCR was used to verify correct genomic integration. Sporulation and tetrad analysis were as described (Guthrie and Fink 1991). The human smORF2 coding sequence was amplified from I.M.A.G.E. clone 1047404 (Research Genetics). The yeast smORF2 was amplified from genomic DNA. PCR fragments were cloned into pYES2.1/V5-His-TOPO (Invitrogen) and transformed into yeast as described (Guthrie and Fink 1991).
WEB SITE REFERENCES
http://www.LabOnWeb.com; Aspergillus fumigatus genomic sequences are available on the Web.
http://www.genetics.wisc.edu/; Escherichia coli Genome Center. October 13, 1998, revision date: E. coli Genome Center, University of Wisconsin, Madison.
http://genome-www.stanford.edu/Saccharomyces/; Saccharomyces Genome Database as of December 5 1997.
http://genome-www.stanford.edu/Saccharomyces/; Saccharomyces Genome Database as of October 2001.
http://www.molbio.oc.ac.uk; Codon adaptation index (CAI).
Acknowledgments
We thank Kim Fechtel for valuable suggestions and for critical reading of the manuscript.
The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC section 1734 solely to indicate this fact.
NOTE ADDED IN PROOF
While this paper was in being reviewed, Fichtner and Schaffrath reported the isolation of the KTI11 gene by complementation of zymocin-resistant yeast mutants. Kti11p is smORF2. (Fichtner, L. and Schaffrath R. 2002. KTI11 and KTI13, Saccharomyces cerevisiae genes controlling sensitivity to G1 arrest induced by Kluyveromyces lactis zymocin. Mol. Microbiol. 44: 865–875.)
Footnotes
-
↵1 Corresponding author.
-
E-MAIL arturo.morales{at}genomecorp.com; FAX (781) 398-2476.
-
Article and publication are at http://www.genome.org/cgi/doi/10.1101/gr.232903.
-
- Received March 1, 2002.
- Accepted November 7, 2002.
- Cold Spring Harbor Laboratory Press



















